《【病毒外文文獻(xiàn)】2019 Development and Evaluation of a Multiplexed Immunoassay for Simultaneous Detection of Serum IgG Antibodies to Six H》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2019 Development and Evaluation of a Multiplexed Immunoassay for Simultaneous Detection of Serum IgG Antibodies to Six H（8頁珍藏版）》請?jiān)谘b配圖網(wǎng)上搜索。

1SCIENTIFIC REPORTS 2019 9 1390 w v w v y z w v w y z Development and Evaluation of a Multiplexed Immunoassay for Simultaneous Detection of Serum IgG Antibodies to Six Human Coronaviruses Suvang U Trivedi w Congrong Miao x Joseph E Sanchez x Hayat Caidi x Azaibi Tamin x Lia Haynes x Received 27 September 2018 Accepted 3 December 2018 Published xx xx xxxx OPEN 2SCIENTIFIC REPORTS 2019 9 1390 w v w v y z w v w y z coupled with molecular detection assays is an ef fective approach in population based surveillance studies 10 We have developed and validated hCoV recombinant nucleocapsid protein recN indirect ELISAs that individu ally detect immunoglobulin G IgG antibodies to all six hCoVs T he hCoV nucleocapsid N protein is abundantly expressed during infection and is therefore one of the ideal candidate antigens for the development of microtiter plate based ELISAs 11 However traditional plate ELISAs are limited to detecting IgG antibodies to a single hCoV recN antigen per well In contrast a magnetic bead based multiplexed immunoassay MMIA would allow for the simultaneous detection of IgG antibodies to all six hCoV recN in a single test well reducing sample consumption In addition multiplexing would allow higher sample throughput at lower reagent labor and material costs without losing sensitivity and specif icity of traditional ELISAs T he present work describes the development and validation of a MMIA to detect human serum IgG against six hCoV recN as a next generation screening tool in population based seroprevalence studies Results Titration of Antigen Concentration A monoplex assay for each hCoV recN conjugated bead set was developed and standardized to determine optimum antigen quantity per bead coupling reaction optimum serum dilution and assay cut of f mean f luorescent intensity MFI values Each bead set was conjugated with 1 0 g 2 5 g or 5 0 g of antigen per 100 l of conjugation reaction 1 25 10 6 beads A checkerboard titration assay was carried out for each antigen against a series of 2 fold 1 100 1 800 positive and negative control sera T he optimum working antigen amounts were determined to be 1 0 g for SARS CoV recN His BoNT NL63 recN 2 5 g for 229E recN MERS CoV recN OC43 recN3 pET E coli and 5 0 g for HKU1 recN per conjugation reaction 1 25 10 6 beads Fig uni00A01 Based on positive serum control titration results optimum dilutions for each antigen were determined to be 1 400 for OC43 NL63 HKU1 and SARS CoV and 1 800 for 229E and MERS CoV Fig uni00A01 T he optimum antigen quantities and positive control serum dilutions were selected based highest signal to background ratio most reproducible results and economical usage of antigen stocks Correlation between monoplex and multiplex assay We compared the MFI values generated by monoplex assays with multiplex assay for each antigen to investigate possible loss of sensitivity due to drop in MFI values Positive control serum pools for each hCoV were serially diluted in 2 fold dilutions 1 100 1 51200 and screened using monoplex and multiplex microsphere immunoassays In each assay format 200 beads 100 beads in duplicate were counted for each recN conjugated bead set Linear regression analysis was performed to determine correlation coef f icient for each recN antigen For all recN bead sets statistically signif icant correlations were observed between the monoplex and multiplex formats with a correlation coef f icient R 2 ranging from 0 88 to 0 97 Fig uni00A02 To determine the sensitivity specif icity and cut of f MFI values for each antigen receiver operating characteristic ROC analysis was carried out based on screening of human sera collected from individuals whose respiratory specimens were tested by reverse real time polymerase chain reaction rRT PCR for presence or absence of hCoV infections Acute and convalescent phase sera from individuals tested positive for hCoVs 229E NL63 OC43 and HKU1 infections as well as convalescent phase sera from conf irmed positive infections of MERS CoV and SARS CoV were screened using MMIA Additionally paired sera from individuals tested negative for hCoV infection were also screened using MMIA Percentage sen sitivity Se and specif icity Sp for each recN was estimated over a wide range of cut of f MFI values and plot ted as Two Graph Receiver Operating Characteristic curve TG ROC using SPSS sof tware Data not shown T he MFI value at which the paired values of Se and Sp were optimal intersection of Se and Sp graph lines were selected as the cut of f MFI for respective recN antigen data not shown T he cut of f MFI values of 1333 513 228 1171 1333 and 520 were selected for 229E NL63 OC43 HKU1 SARS CoV and MERS CoV recN monoplex assays respectively T he corresponding sensitivity and specif icity values are described in Tableuni00A01 To determine the overall assay performance of MMIA areas under curves AUCs were calculated for all six hCoV recN using RT PCR as the reference diagnostic test Fig uni00A03 T he calculated AUC values for 229E NL63 OC43 HKU1 SARS CoV and MERS CoV recN were 0 938 0 869 0 890 0 906 0 873 and 0 913 respectively Fig uni00A03 indicating moderate to high level of test accuracy Reproducibility of Multiplex Microsphere Immunoassay To assess the reproducibility of the MMIA a panel of positive control serum samples for each hCoV was run in duplicate at optimum serum dilutions on two dif ferent plates on the same day and was repeated with a new batch of conjugated beads on a dif ferent day Coef f icients of variation CV for each replicate for each antigen was calculated and averaged Tableuni00A02 All assays except NL63 recN gave CV values below 10 indicating MMIA precision Cross reactivity between recN antigens To examine cross reactivities between all hCoV recN in human sera we screened each positive control of hCoV in a multiplex format at dilutions ranging 1 100 1 800 T he results show overall minimum cross reactivity amongst hCoV recN Fig uni00A04 However positive controls of the hCoVs of the same antigenic groups showed cross reactivity with each other Positive controls of group 1 alpha human coronaviruses 229E and NL63 showed reactivity with each other but not with group 2 hCoVs However SARS CoV group 2b positive control serum reacted with group 1 CoVs 229E and NL63 Positive control serum for OC43 a group 2a beta coronavirus reacted with HKU1 recN another member of group 2a whereas positive control for MERS CoV group 2c reacted with HKU1 recN 3SCIENTIFIC REPORTS 2019 9 1390 w v w v y z w v w y z Discussion Use of bead based multiplexed immunoassay technology has been gaining recognition as a next generation screening tool in seroprevalence studies Several research groups have reported the development of bead based multiplexed immunoassays to detect antibodies against a variety of human viral pathogens A duplex assay was developed to detect IgG against recombinant nucleocapsid proteins of human respiratory syncytial virus hRSV and human metapneumovirus hMPV 10 A quadruplex assay was developed to detect IgGs against measles mumps rubella and varicella zoster virus 12 A thirteen plexed immunoassay has been developed to detect IgM and IgGs for serodetection of arboviruses 13 T he results of the current study shows that it is feasible to use a multiplexed bead immunoassay to screen human sera for IgGs against the six human coronavirus recombinant nucleocapsid proteins T he use of ROC analysis in our study not only facilitated selection of optimal MFI cut of f values but also helped determine the accuracy and usefulness of our test method by calculating the area under the ROC curves 14 A perfect test has an AUC of 1 and a useless test has an area of 0 5 the equivalent of a coin toss Based on arbitrary criteria the following guidelines have been suggested for interpretation of AUC values in context of test accuracy low 0 5 AUC 0 7 moderate 0 7 AUC 0 9 and high 0 9 AUC 1 15 Based on our assay test results the calculated AUC ranged from 0 87 to 0 94 suggesting a high to high moderate levels of accuracy and overall assay performance T he cross reactivity experiment results showed positive control of SARS CoV reacting with group 1 hCoVs 229E and NL63 recN A major limitation of these assays is that we are unable to distinguish the dif ference between cross reactivity and evidence of previous infections SARS CoV recN has been shown to react Figure 1 Titration of recombinant nucleocapsid recN proteins of hCoVs A 229E B NL63 C OC43 D HKU1 E SARS CoV and F MERS CoV at concentrations of 1 0 g uni25A1 2 5 g uni2206 and 5 0 g uni25CB per conjugation reaction Positive and negative controls for each hCoV were tested at dilutions 1 200 1 400 and 1 800 Mean Fluorescence Intensity MFI values of negative control antigens pET E coli and His BoNT were subtracted from the MFI values of corresponding positive control antigen for each antigen 4SCIENTIFIC REPORTS 2019 9 1390 w v w v y z w v w y z with polyclonal antisera of group 1 coronaviruses in a western blot analysis 16 However this cross reactivity was one way from SARS CoV to other hCoV recN in this study which has also been previously conf irmed by Che et al in a separate study 17 T he multiple sequence identity matrix of all hCoV nucleocapsid protein sequences show amino acid homology ranging from 20 to 63 data not shown In contrast group 1 hCoVs showed only 20 to 22 sequence homology with group 2 hCoVs which explains the lack of detectable cross reactivity between Figure 2 Correlation of Mean Fluorescence Intensity MFI values between monoplex and multiplex microsphere immunoassays using positive control serum for A 229E B NL63 C OC43 D HKU1 E SARS CoV and F MERS CoV Cut of f MFI Sensitivity Pos Total Specif icity Neg Total 229E recN 1333 100 8 8 88 75 71 80 NL63 recN 513 83 33 15 18 83 75 67 80 OC43 recN3 228 80 95 34 42 81 25 65 80 HKU1 recN 1171 89 28 25 28 86 25 69 80 MERS CoV recN 1333 85 71 6 7 95 00 76 80 SARS CoV recN 520 80 00 4 5 85 00 68 80 Table 1 Diagnostic sensitivity and specif icity of all six hCoV recN in Luminex multiplex microsphere immunoassay in relation to cut of f MFIs and sensitivity and specif icity determined af ter ROC analysis of known positive and negative sera 5SCIENTIFIC REPORTS 2019 9 1390 w v w v y z w v w y z these two antigenic groups However sequence homology was high between nucleocapsid sequences of OC43 and HKU1 and that of HKU1 and MERS CoV Higher percentage of nucleocapsid protein sequence homology may indicate the shared epitopes in the conserved and or overlapping regions between hCoVs of the same antigenic groups Since the previous hCoV infection history of patients enrolled in the study was una vailable dual infection with OC43 and HKU1 could also have contributed to the cross reactivity though that is unlikely for HKU1 and MERS CoV Our hCoV MMIA of fers high throughput testing at reduced cost the assay can be completed in less time with less labor using less clinical specimen and assay reagents Moreover MMIA allows the f lexibility of mixing and matching the bead sets depending upon the analysis requirements Overall the results of our study showed that development of a bead based multiplex immunoassay for screening human sera for IgG antibodies against hCoV recN proteins is feasible and may serve as an ef fective tool for large scale seroprevalence studies such as examining prevalence of hCoVs in young children of dif ferent ages Figure 3 Receiver Operating Characteristic curve ROC analysis to determine area under the curve AUC values for A 229E B NL63 C OC43 D HKU1 E SARS CoV and F MERS CoV recN in MMIA using real time RT PCR as the reference diagnostic test Within plate CV Between plates CV Between assays CV n 24 n 48 n 94 229E 2 2 6 NL63 5 12 23 HKU1 2 3 6 OC43 6 4 6 SARS CoV 8 8 6 MERS CoV 2 2 3 Table 2 Assay reproducibility of the Luminex multiplex microsphere immunoassay CV percent coef f icient of variation 6SCIENTIFIC REPORTS 2019 9 1390 w v w v y z w v w y z Materials and Methods Human Serum Samples All methods were carried out in accordance with CDC s institutional review board IRB guidelines and regulations All protocols were approved by CDC s IRB All patients were hospitalized with pneumonia symptoms gave informed consent and their respiratory specimens were tested by rRT PCR to deter mine etiology Paired acute and convalescent phase human sera collected from individuals whose respiratory spec imens were tested positive for hCoV 229E n 4 hCoV NL63 N 9 hCoV OC43 n 21 and hCoV HKU1 n 14 by rRT PCR were included in a positive control panel for the study Human sera from patients with conf irmed SARS CoV n 5 and MERS CoV infections n 7 tested during outbreak investigation by our laboratory were also included to the positive control panel Acute sera were collected upon hospital admission and convalescent phase sera were obtained 3 7 weeks later From this panel of positive sera convalescent phase sera exhibiting 4 fold increase in IgG titers were pooled together to create a positive control for each hCoV recN Similarly acute and convalescent phase human sera collected from individuals with acute respiratory illness whose respiratory specimens tested negative for all six hCoVs by real time RT PCR and exhibited no IgG reactivity when screened by in house hCoV recN enzyme immunoassays were included to create a negative control panel For this study we chose to use recombinant coronavirus nucleocapsid N proteins N antigens T he full length SARS CoV recN and a negative control antigen the nontoxic 50 kDa C terminal fragment of the botulinum neurotoxin serotype A BoNt HcA were expressed and purif ied as described previously 18 Expression and purif ication of full length hCoV 229E recN hCoV NL63 recN hCoV HKU1 recN MERS CoV recN and purif ied protein from E coli containing pET 28 vector without the N gene as a negative antigen control were carried out as described previously for hCoV OC43 recN3 19 Brief ly RNAs of respective hCoV 229E NL63 HKU1 and MERS CoV nucleocapsid N genes were amplif ied by RT PCR using following primer pairs 229E forward 5 GGATCCCATATGGCTACAGTCAAATGGGCTG 3 and reverse 5 GGACTCGAGCTCTTAGTTTACTTCATCAATTATGTCAG 3 NL63 forward 5 GGATC CCATATGGCTAGTGTAAATTGGGCCGATG 3 and reverse 5 CTCGAATTCTTATTAATGCAAAACC TCGTTGAC 3 HKU1 forward 5 CGGAATTCGATGTCTTATACTCCCGGT 3 and reverse 5 TTTTCCTTT TGCGGCCGCTTAAGCAACAGAGTCTTCTA 3 MERS CoV forward 5 GGATCCCATATGGCATCCC CTGCTGCACCTCGTGCT 3 and reverse 5 CTCGAATTCTTACTAATCAGTGTTAACATCAATCAT 3 T he amplif ied genes were cloned into a pET 28 vector encoding a C terminal polyhistidine His 6 tag Recombinant anti gens were expressed by IPTG induction in Escherichia coli strain BL21 DE3 cells and were purif ied by metal af f inity chromatography QIAGEN Valencia CA Purif ied proteins were analyzed by SDS PAGE and western blots ELISA T he positive and negative control human sera panels were f irst tested by in house hCoV recN ELISAs to determine titers of IgG antibodies against individual hCoV recN All human sera were initially tested in dupli cate at 1 200 followed by titration at a 4 fold dilution range of 1 100 to 1 6400 In house indirect ELISAs for recN have been developed and standardized for screening of serum samples for IgG reactivity against hCoV 229E recN hCoV NL63 recN hCoV HKU1 recN and MERS CoV recN using modif ied version of previously described indirect ELISAs for SARS CoV recN and hCoV OC43 recN3 Haynes et al 18 Blanchard et al 19 Brief ly 96 well transparent f lat bottom Immulon 2HB microtiter plates T hermo Scientif ic Rochester NY were coated with purif ied hCoV 229E recN 6 75 ng well hCoV NL63 recN 5 ng well hCoV OC43 recN3 25 ng well hCoV HKU1 recN 40 ng well MERS CoV recN 40 ng well or SARS CoV recN 12 5 ng well and negative control antigens pET E coli 5 0 40 ng well or His BoNT 12 5 ng well diluted in sterile phos phate buf fered saline PBS pH 7 4 and incubated overnight at 2 8 C T he next day plates were washed three times with 150 l of PBS T PBS containing 0 05 Tween 20 and incubated with serum dilutions prepared in PBS T M PBS containing 0 05 Tween 20 and 5 skim milk for 1 h at 37 C Following incubations the plates were washed three times in PBS T and incubated with 1 4000 dilution of HRP conjugated goat anti human IgG H L KPL Gaithersburg MD prepared in PBS T M for 1 h at 37 C Following incubation plates were washed three times with 150 l of PBS T and incubated with ABTS peroxidase substrate 2 2 azino di 3 et hylbenzthiazoline 6 sulfonate KPL Gaithersburg MD at 37 C for 30 min T he reaction was terminated by adding ABTS peroxidase stop solution 5 sodium dodecyl sulfate and the optical density OD measured at 405 490 nm using a TECAN Inf inity microplate reader Mannedof Switzerland T he OD values of the negative Figure 4 Cross reactivity of hCoV recN conjugated beads with Positive control serum samples for all six hCoVs in a multiplex microsphere immunoassay MMIA 1 400 dilution 7SCIENTIFIC REPORTS 2019 9 1390 w v w v y z w v w y z control wells n were subtracted from and divided by the OD values of antigen coated wells p and the average OD values of the antigen coated wells were calculated as the dif ference p n and ratio p n Conjugation of viral antigens to carboxylated magnetic beads Purif ied His tagged whole or trun cated recN of hCoV 229E hCoV NL63 hCoV OC43 hCoV HKU1 SARS CoV and MERS CoV along with pET E coli and His BoNT as negative antigen controls were covalently conjugated to eight spectrally distinct MagPlex pro magnetic microsphere bead sets Luminex Corporation Austin TX using the two step car bodiimide coupling protocol provided with Bio Plex amine coupling kit Bio Rad Laboratories Hercules CA All washing steps were performed using a magnetic separator Luminex T he beads were vortexed vigorously for 30 sec and sonicated for 15 sec in order to disperse the bead aggregates For 1X scale conjugation reaction 1 25 10 6 of monodispersed beads from each bead set were washed in PBS pH 7 4 T he washed beads were activated by incubation in 100 l of activation buf fer provided with the kit containing freshly prepared 10 l of 50 mg ml N hydroxysulfosuccinimide sodium salt sulfo NHS Pierce Rockford IL USA and 10 l of 50 mg ml 1 Ethyl 3 3 dimethlyaminopropyl carbodiimide hydrochloride EDC Pierce for 20 min at room temperature in the dark with continuous shaking T he activated beads were washed twice with PBS pH 7 4 Coupling was performed by suspending the activated beads in 500 l of PBS pH 7 4 containing 1 0 g 2 5 g or 5 0 g of hCoV recN or its corresponding negative control antigen and incubation for 2 h at room temperature in dark with con tinuous shaking T he covalently linked beads were washed once with 500 l PBS pH 7 4 resuspended in 250 l StabiliGuard02 SG02 Surmodics Inc Minneapolis MN and incubated at 37 C for 2 h in the dark with con tinuous shaking Finally the beads were magnetically separated and resuspended in 150 l of SG02 enumerated using a hemocytometer and stored at 2 8 C in the dark until use recN Monoplex Immunoassay All recN conjugated bead sets 229E recN 78 NL63 recN 20 OC43 recN3 65 HKU1 recN 44 MERS CoV recN 72 SARS CoV recN 26 pET E coli Neg ctrl 12 and His BoNT Neg ctrl 12 were brought to room temperature prior to performing the monoplex immunoassay Beads were vortexed for 30 sec and then sonicated in a water bath sonicator Branson ultrasonic cleaner VWR International West Chester PA for 20 sec Each bead set was diluted in PBS pH 7 4 to a f inal concentration of 100 beads region l of PBS pH7 4 A series of 2 fold dilutions 1 100 1 800 of positive and negative control sera were prepared in SurModics Assay Diluent cat SM01 1000 SurModics MN In a black 96 well non binding microtiter plate Greiner Bio One Germany 50 l of diluted beads 100 beads region l and 50 l of diluted control serum were mixed using microtiter pipette An additional 50 l of PBS pH 7 4 was added to each of the well of the plate T he plate was covered with aluminum foil and incubated fo