《【病毒外文文獻(xiàn)】2010 Effect of mucosal and systemic immunization with virus-like particles of severe acute respiratory syndrome coronavi》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2010 Effect of mucosal and systemic immunization with virus-like particles of severe acute respiratory syndrome coronavi（8頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

Effect of mucosal and systemic immunization with virus like particles of severe acute respiratory syndrome coronavirus in mice Introduction Severe acute respiratory syndrome coronavirus SARS CoV is a newly identified coronavirus that causes severe acute respiratory syndrome in humans through respira tory transmission 1 2 SARS CoV is an enveloped positive stranded RNA virus which has four major structural pro teins namely spike S envelope E membrane M and Baojing Lu 1 2 Yi Huang 1 Li Huang 1 Bao Li 2 Zhenhua Zheng 1 Ze Chen 1 Jianjun Chen 1 Qinxue Hu 1 and Hanzhong Wang 1 1 State Key Laboratory of Virology Wuhan Institute of Virology Chinese Academy of Sci ence Wuhan and 2 Anhui Medical University Hefei China doi 10 1111 j 1365 2567 2010 03231 x Received 14 August 2009 revised 26 October 2009 4 December 2009 accepted 9 December 2009 Correspondence Dr H Wang or Dr Q Hu State Key Laboratory of Virology Wuhan Institute of Virology Chinese Academy of Sciences Wuhan 430071 Hubei China Emails wanghz or huqinxue Senior author Dr B Lu email lubaojing Summary Nasal administration has emerged as a promising and attractive route for vaccination especially for the prophylaxis of respiratory diseases Our pre vious studies have shown that severe acute respiratory syndrome corona virus SARS CoV virus like particles VLPs can be assembled using a recombinant baculovirus rBV expression system and such VLPs induce specific humoral and cellular immune responses in mice after subcutane ous injection Here we investigated mucosal immune responses to SARS CoV VLPs in a mouse model Mice were immunized in parallel intraperitoneally or intranasally with VLPs alone or with VLPs plus cyto sine phosphate guanosine CpG Immune responses including the pro duction of SARS CoV specific serum immunoglobulin G IgG and secretory immunoglobulin A sIgA were determined in mucosal secre tions and tissues Both immunizations induced SARS CoV specific IgG although the levels of IgG in groups immunized via the intraperitoneal i p route were higher sIgA was detected in saliva in groups immunized intranasally but not in groups immunized intraperitoneally CpG had an adjuvant effect on IgA production in genital tract washes when adminis tered intranasally but only affected IgA production in faeces samples when administered intraperitoneally In addition IgA was also detected in muco sal tissues from the lung and intestine while CpG induced an increased level of IgA in the intestine Most importantly neutralization antibodies were detected in sera after i p and intranasal i n immunizations Secre tions in genital tract washes from the i n group also showed neutralization activity Furthermore VLPs that were administered intraperitoneally elic ited cellular immune responses as demonstrated by enzyme linked immu nospot ELISPOT assay analyses In summary our study indicates that mucosal immunization with rBV SARS CoV VLPs represent an effective means for eliciting protective systemic and mucosal immune responses against SARS CoV providing important information for vaccine design Keywords cytosine phosphate guanosine CpG mucosal immunization severe acute respiratory syndrome coronavirus SARS CoV virus like par ticles Abbreviations CpG cytosine phosphate guanosine ELISA enzyme linked immunosorbent assay ELISPOT enzyme linked immunospot FBS fetal bovine serum HIV human immunodeficiency virus IFN c interferon c IgA immunoglobulin A IgG immunoglobulin G IL interleukin i n intranasal i p intraperitoneal mAb monoclonal antibody ODN oligodeoxynucleotide rBV recombinant baculovirus SARS CoV severe acute respiratory syndrome coronavirus SD standard deviation sIgA secretory IgA SPF specific pathogen free TMB 3 3 0 5 5 0 tetramethylbenzidine VLPs virus like particles 254 C211 2010 Blackwell Publishing Ltd Immunology 130 254 261 IMMUNOLOGY ORIGINAL ARTICLE nucleocapsid N proteins 3 5 S protein contains impor tant virus neutralizing epitopes and amino acid changes in the S protein can dramatically affect viral virulence The M protein is the most abundant structural protein spanning the membrane bilayer three times and plays a key role in coronavirus assembly The small E protein is a minor structural component containing a hydrophobic region flanked by hydrophilic termini To prevent another SARS epidemic continuous efforts have been made towards the development of a prophy lactic vaccine Most of the currently used antiviral vac cines are based on homologous inactivated or attenuated viral particles However reversion of an attenuated live vector to a virulent strain by genetic recombination can not be excluded precluding the use of this strategy for many pathogens 6 Virus like particles VLPs represent a specific class of subunit vaccine that mimics the struc ture of authentic virus particles VLPs are safer than inactivated or attenuated viral particles and are more likely to stimulate stronger immune responses than sin gle protein based vaccines 7 Systems for constructing VLPs have been well explored in human immunodefi ciency virus HIV rotavirus hepatitis C virus HCV and human papillomavirus HPV 8 14 Currently VLPs as an antigen presenting and delivery system are under investigation in preclinical studies or clinical trials against different human viruses For example an effec tive HPV VLP vaccine was developed and has been used in clinical trials 15 17 Given the highly infectious nature of SARS CoV VLPs represent a potential option for SARS vaccine develop ment We and others have recently demonstrated that SARS CoV VLPs can be assembled by coinfection with recombinant baculoviruses rBVs 18 19 We also investi gated the immunogenicity of SARS CoV VLPs after administration via subcutaneous injection in mice and found that SARS CoV VLPs activated immature dendritic cells and enhanced the expression of costimulatory mole cules and the secretion of cytokines in vitro 20 21 In addition to the systemic immune responses muco sal immune responses inducing local antibodies are criti cal because the mucosa is often the portal for inhaled antigens To date intranasal i n immunization is emerging as possibly the most effective route for vacci nation Because the transmission route of SARS CoV is through the mucosal membranes of the eyes nose or mouth 2 a vaccine to achieve mucosal immunity should be considered as the primary goal for SARS vaccine development In this study we evaluated the immunoge nicity of SARS CoV VLPs when administered through the mucosal route Our data demonstrate that intraperi toneal i p and i n immunization with VLPs with or without a cytosine phosphate guanosine CpG adju vant elicit both systemic and mucosal immune responses in mice Materials and methods Adjuvants The CpG oligodeoxynucleotide ODN 10104 TCGT CGTTTCGTCGTTTTGTCGTT and the non CpG 2137 TGCTGCTTTTGTGCTTTTGTGCTT were purchased from Coley Pharmaceutical Canada Ottawa ON Canada Production and purification of SARS CoV VLPs VLPs formed by the S E and M proteins of SARS CoV were successfully constructed in our previous study using a baculovirus system 21 Briefly Sf21 insect cells were co infected with two rBVs one expressing the S protein and the other expressing the E and M proteins at a multiplicity of infection of 5 At 4 days postinfection the culture medium and the cells were collected and freeze thawed twice to release VLPs The sample was then cen trifuged at 5000 g and the supernatant was filtered through a 0C145 lm pore size filter The lysates were pelleted at 150 000 g for 3 hr placed on a 30 50 w w sucrose density gradient and then centrifuged at 200 000 g for 3 hr A visible band between the 30 and 40 sucrose layers was collected and pelleted by centrifu gation at 150 000 g for 3 hr The pellets were resuspended in phosphate buffered saline BS and used for immuni zation The total protein concentration of VLPs was determined using a Bio Rad Hercules CA protein assay The incorporation of SARS CoV VLPs was determined using electron microscopy and Western blotting Immunization protocols Female BALB c mice 6 8 weeks of age were purchased from Hubei CDC Wuhan China and maintained in a specific pathogen free SPF environment throughout the experiments Mice n 6 per group were randomly divided into 10 groups Immunizations intranasally or intraperitoneally with SARS CoV VLPs 20 lg either alone or mixed with CpG ODN or the non CpG control were performed at weeks 0 2 4 and 6 Table 1 All reagents were suspended in 20 ll of PBS and individual mice received 10 ll twice with a 30 min rest interval between each nasal administration of vaccine Mice were anesthetized slightly with sodium pentobarbital and held in an inverted position with the nose down until droplets of vaccine that were applied to both external nares had been completely inhaled Sample collection Samples of serum saliva vaginal lavage fluids faeces intestine and lung were collected 2 weeks after the final immunization from three mice in each group Blood C211 2010 Blackwell Publishing Ltd Immunology 130 254 261 255 Mucosal immune responses of SARS CoV VLPs in mice samples were collected by retro orbital plexus puncture Saliva was procured after i p injection of 20 lg of car bamylcholine chloride 22 Genital tract fluid was collected by washing with 20 ll of PBS five times per day for 3 days Faecal extraction was obtained by adding 100 mg of faecal pellets to 1 ml of PBS containing 0C11 sodium azide Lung and small intestine tissues were weighed cut into small pieces 2 3 mm long suspended in extraction buffer 2 saponin 0C11 NaN 3 in PBS rocked over night 100 mg of lung in 400 ll of extraction buffer and 100 mg of small intestine in 200 ll of extraction buf fer and supernatants were collected after centrifugation 23 All samples were stored at 20C176 before to antibody titration Enzyme linked immunosorbent assay analysis Enzyme linked immunosorbent assay ELISA was used to determine the titres of specific antibodies as previously described with modifications 24 Briefly 5 lg ml of inacti vated SARS CoV in 0C11 M carbonate buffer pH 9C16 was used to coat 96 well microtitre plates Corning Costar Acton MA at 4C176 overnight After the plates were blocked with 1 bovine serum albumin BSA a series of diluted samples was added and incubated at 37C176 for 1 hr then washed three times with PBS containing 0C105 Tween 20 Specific antibodies were detected by incubation with alka line phosphatase conjugated goat anti mouse immuno globulin G IgG or immunoglobulin A IgA Sigma St Louis MO at 37C176 for 1 hr followed by three washes The reaction was visualized by addition of the substrate para nitrophenyl phosphate and the absorbance at 405 nm was measured using an ELISA plate reader Bio RAD Hercules CA Antibody positive cut off values were set as means 2 standard deviation SD of non immunized mice i e PBS immunized mice and the titre was expressed as the highest serum dilution giving a positive reaction Values were presented as means SD of three mice of each group Neutralization assay For the neutralization assay HIV based pseudoviruses were prepared as previously described 25 In brief 12 lg each of pHIV Luc pNL4 3 Luc R E Luc and the S pro tein expressing plasmids were cotransfected into 2 10 6 293T cells in 10 cm dishes The medium was replaced with fresh medium 8 hr after transfection Pseudotype vector containing supernatants were harvested at 48 hr post transfection clarified from cell debris by centrifuga tion at 3000 g and filtered through a 0C145 lm pore size filter Millipore Billerica MA before storage at 70C176 in aliquots for the neutralizing test A detailed neutralization assay has been described pre viously 26 In brief HeLa hACE2 cells 2 10 4 cells well were seeded into 96 well plates 18 hr before infection The next day serum samples were heat inactivated at 56C176 for 30 min and serially diluted twofold in Dulbecco s modified Eagle s minimal essential medium A final vol ume of 30 ll of the heat inactivated diluted serum was mixed with 10 ng of pseudoviruses suspended in 30 llof Dulbecco s modified Eagle s minimal essential medium and incubated at 37C176 for 1 hr After incubation 40 llof medium containing 16 ng of polybrene was added to 96 well microtitre plates Following 3 hr of incubation at 37C176 serum virus mixtures were replaced with cell culture medium The plates were incubated at 37C176 in the presence of 5 CO 2 for 2 days and the infection was monitored by measuring luciferase activity expressed from the reporter gene carried by the pseudovirus using a luci ferase assay system Promega Madison WI The neutral izing antibody titre was defined as the highest dilution of tested samples that reduced virus infectivity by 50 compared with negative control samples Enzyme linked immunospot assay Nitrocellulose membranes of 96 well enzyme linked im munospot ELISPOT plates Millipore Molseheim France were pre wet with 15 ll of 70 ethanol then coated overnight at 4C176 with 100 ll of anti mouse inter feron c IFN c or15lg ml of interleukin IL 4 mono clonal antibody mAb Mabtech Stockholm Sweden The antibody coated plates were blocked with RPMI 1640 containing 10 fetal bovine serum FBS for at least 2 hr at room temperature then 1 10 6 splenocytes in 100 ll of medium RPMI 1640 containing 10 FBS 10 mM glutamine 100 U ml of penicillin and 100 lg ml of streptomycin also containing 10 lg ml of purified recombinant S protein were incubated for 20 hr at 37C176 All stimulation conditions were tested in triplicate and cell viability was confirmed by adding 4 lg ml of conca Table 1 Immunization schedule Group Immunization route SARS CoV VLPs lg CpG ODN lg Non CpG ODN lg 1 Ag i p 20 0 0 2 Ag 10 lg CpG i p 20 10 0 3 Ag non CpG i p 20 0 10 4 PBS i p 0 0 0 5 CpG i n 0 10 0 6 Ag i n 20 0 0 7 Ag 10 lg CpG i n 20 10 0 8 Ag non CpG i n 20 0 10 9 PBS i n 0 0 0 10 CpG i n 0 10 0 Ag antigen CpG cytosine phosphate guanosine ODN oligodeox ynucleotide PBS phosphate buffered saline SARS CoV severe acute respiratory syndrome coronavirus VLPs virus like particles 256 C211 2010 Blackwell Publishing Ltd Immunology 130 254 261 B Lu et al navalin A Con A Sigma The plates were washed five times with PBS containing 0C105 Tween then incubated with 100 ll of biotinylated anti mouse IFN c or IL 4 mAb 1 lg ml in PBS containing 0C15 FBS Mabtech for 2 hr at room temperature After five washes 100 ll of streptavidin horseradish peroxidase reagent was added Following 1 hr of incubation at room tempera ture and five subsequent washes 100 ll of 3 3 0 5 5 0 tetra methylbenzidine TMB substrate was added for 15 min The reaction was terminated by discarding the substrate solution and washing the plates under running tap water After drying the spots were scanned and counted using ELISPOT image analysis Biosys Karben Germany The number of spot forming cells SFC per 10 6 splenocytes was calculated Statistical analysis All data are presented as the mean SD SPSS 13C10 for Windows was used for statistical analysis Statistical analy sis was assessed using the Student s t test A P value of 0C105 was considered statistically significant Results Specific IgG response in sera induced by i n and i p immunization Two weeks after the final immunization sera from i n and i p immunization groups were collected to detect SARS CoV specific IgG induced by VLPs Specific IgG levels were greatly enhanced in all groups of mice As shown in Fig 1 both immunization protocols with VLPs alone or with CpG adjuvant induced SARS CoV specific IgG The IgG level was higher in the i p immu nization group than in the i n immunization group as expected P 0C101 CpG failed to enhance immune responses in the serum samples when administered by either route Antibody responses in mucosal secretions Mucosal surface secretory IgA sIgA may play an impor tant role in protecting against viral infection and there fore the specific sIgA levels in different mucosal secretions were assayed using ELISA In the i p immunization group the following results were obtained no detectable specific sIgA was found in saliva Fig 2a low but detectable specific sIgA was found in genital tract washes when the mice were immunized with VLPs alone Fig 2b and VLPs administered with 10 lg of CpG induced a specific sIgA response in faeces Fig 2c P 0C105 In the i n immunization group the following results were obtained specific sIgA was induced in saliva but there was no sig nificant difference between groups immunized with or without CpG Fig 2a in the absence of adjuvant VLPs induced specific sIgA in the genital tract P 0C101 com pared with PBS group and the titres were enhanced IgG in serum Ag 0 0 3 0 6 0 9 0 Titre Log2 12 0 Ag 10 g CpG Ag non CpG PBS i n i p Figure 1 Severe acute respiratory syndrome coronavirus SARS CoV specific immunoglobulin G IgG responses after intraperito neal i p and intranasal i n immunization with virus like particles VLPs Data shown are the mean standard deviation SD of two independent experiments performed in triplicate on three animals in each group with each condition a b c SIgA in saliva SIgA in genital tract SIgA in faeces Ag 0 0 1 0 2 0 3 0 Titre Log2 Titre Log2 Titre Log2 4 0 0 0 2 0 4 0 6 0 0 0 1 0 2 0 3 0 8 0 Ag 10 g CpG Ag non CpG PBS Ag Ag 10 g CpG Ag non CpG PBS Ag Ag 10 g CpG Ag non CpG PBS i n i p i n i p i n i p Figure 2 Severe acute respiratory syndrome coronavirus SARS CoV specific secretory immunoglobulin A sIgA responses in mucosal secretions Mucosal secretions i e saliva genital tract washes and faecal extracts were collected on day 56 Each bar repre sents the arithmetic mean titre standard deviation SD of individ ual groups for SARS CoV specific sIgA a SARS CoV specific sIgA in saliva from intraperitoneal i p and intranasal i n immuniza tion groups b SARS CoV specific sIgA in genital tract washes from i p and i n immunization groups c SARS CoV specific sIgA in faecal extracts from i p and i n immunization groups C211 2010 Blackwell Publishing Ltd Immunology 130 254 261 257 Mucosal immune responses of SARS CoV VLPs in mice P 0C105 there was no significant sIgA response in intestine when VLPs were administered alone P 0C105 and the sIgA levels were increased when 10 lg of adju vant was used P 0C105 Neutralization antibodies in sera and mucosal secretions The level of neutralizing antibodies is critical for protec tion against SARS CoV Here we used HIV based pseud oviruses to determine the anti SARS CoV neutralizing activities in serum and in the genital tract As shown in Fig 4 sera from intraperitoneally and intranasally immu nized mouse groups demonstrated potent anti SARS CoV pseudovirus neutralizing activities Surprisingly the neu tralization titre from i n groups that received VLPs alone was five times higher than that from i p groups and was 25 times higher when co administered with 10 lgof CpG Additionally genital tract washes demonstrated a low but detectable neutralizing antibody titre and CpG contributed to the enhanced production of antibodies Cellular immune responses in SARS CoV VLPs vaccinated mice The type of cellular immune response that was elicited by mice vaccinated intraperitoneally was evaluated using the ELISPOT assay As shown in Fig 5 specific IFN c secretions were induced in all experimental groups compared with the control groups P 0C101 Compared to immunization with VLPs alone the number of cells secreting IL 4 was 1C15 times higher in mice that were co administered CpG Discussion Given the significant health and economic impact of a SARS outbreak an effective vaccine against epidemic and zoonotic strains of the virus is urgently needed To date a variety of candidate vaccines such as DNA 27 adenovi rus mediated 28 a combination of whole killed virus and DNA 29 inactive virus 30 and recombinant proteins or their fragments are under preclinical or clinical study In addi tion VLPs morphologically mimicking the native virus and capable of eliciting strong immune responses repre sent a safe option for vaccine design We previously reported t