《【病毒外文文獻(xiàn)】2010 Specific real-time reverse transcription-polymerase chain reaction for detection and quantitation of turkey coronav》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2010 Specific real-time reverse transcription-polymerase chain reaction for detection and quantitation of turkey coronav（8頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

Journal of Virological Methods 163 2010 452 458 Contents lists available at ScienceDirect Journal of Virological Methods journal homepage Specific real time reverse transcription polymerase and quantitation of turkey coronavirus RNA infected with turkey coronavirus Yi Ning Hooper Department Lafayette Article Received Received in revised form 28 October 2009 Accepted 5 November 2009 Available online 14 November 2009 Keywords Turkey coronavirus Real time TaqMan Spike infection U S are critical to the diagnosis and control of the disease A specific one step real time reverse transcription polymerase chain reaction RRT PCR assay for detection and quantitation of TCoV in the turkey tissues was developed using a dual labeled fluorescent probe The fluorogenic probe labeled with a reporter dye FAM 6 carboxytetramethylrhodamin and a quencher dye AbsoluteQuencher TM was designed to bind to a 186 base pair fragment flanked by the two PCR primers targeting the 3 prime end of spike gene of 1 infection increased to of the prevention 0166 0934 doi RT PCR probe gene TCoV The assay was performed on different avian viruses and bacteria to determine the specificity as well as serial dilutions of TCoV for the sensitivity Three animal trials were conducted to further validate the assay Ten day old turkey poults were inoculated orally with 100 EID 50 of TCoV Intestinal tissues duodenum jejunum ileum cecum feces from the cloacal swabs or feces from the floor were collected at 12h 1 2 3 5 7 and or 14 days post inoculation DPI RNA was extracted from each sample and subjected to the RRT PCR The designed primers and probe were specific for TCoV Other non TCoV avian viruses and bacteria were not amplified by RRT PCR The assay was highly sensitive and could quantitate between 10 2 and 10 10 copies H9262l of viral genome The viral RNA in the intestine segments reached the highest level 6 10 15 copies H9262l in the jejunum at 5 DPI Eighty four intestine segments assayed by the developed RRT PCR and immunofluorescence antibody assay IFA revealed that there were 6 segments negativeforTCoVbybothassays 45positiveforTCoVbyIFA and77positiveforTCoVbyRRT PCR Turkey coronavirus was detected in the feces from the cloacal swabs or floor 1 14 DPI however the viral RNA load varied among different turkey poults at different intervals from different trials The highest amount of viral RNA 2 8 10 10 copies H9262l in the feces was the one from the cloacal swab collected at 1 DPI The average amount of TCoV RNA in the cloacal fecal samples was 10 times higher than that in the fecal droppings on the floor Taken together the results indicated that the developed RRT PCR assay is rapid sensitive and specific for detection differentiation and quantitation of TCoV in the turkey tissues and should be helpful in monitoring the progression of TCoV induced acute enteritis in the turkey flocks 2009 Elsevier B V All rights reserved Introduction Turkey coronaviral enteritis due to turkey coronavirus TCoV causes atrophic enteritis decreased weight gain mortalityandunevenflockgrowthintheturkeysleading significant economic loss in the turkey industry The occurrence turkey coronaviral enteritis is still reported in many states of U S There are no effective vaccine and treatment available for and treatment of the disease Therefore rapid detec Corresponding author Tel 1 765 494 7927 fax 1 765 494 9181 E mail address tllin purdue edu T L Lin tion differentiation and quantitation of TCoV are very critical to monitor and control TCoV infection in the turkey flocks Turkey coronavirus belongs to the antigenic group 3 in the fam ily Coronaviridae It is a pleomorphic enveloped virus with the size about 80 160nm in diameter There are 20nm long club shaped projections around the virions The genomic nucleic acid is a linear positive sense single stranded RNA The major structural proteins include spike S glycoprotein membrane M protein and nucleo capsid N protein The S protein is highly variable among different coronaviruses while M and N protein are more conserved between different antigenic groups The S proteins of coronaviruses have been reported to form peplomer structures on the surface of coro navirus which bind to cell receptors and induce cell fusion and neutralizing antibodies Lu et al 2004 The similarity of S gene see front matter 2009 Elsevier B V All rights reserved 10 1016 j jviromet 2009 11 012 Chen Ching Ching Wu Thomas Bryan Tom of Comparative Pathobiology Purdue University 406 S University St West history 24 June 2009 abstract Turkeycoronavirus TCoV icant economic loss in the chain reaction for detection in tissues and feces from turkeys Donna Schrader Tsang Long Lin IN 47907 2065 USA causesacuteatrophicenteritisintheturkeypoults leadingtosignif turkey industry Rapid detection differentiation and quantitation of TCoV Y N Chen et al Journal of Virological Methods 163 2010 452 458 453 nucleotide and amino acid sequence among coronaviruses varies Although TCoV and infectious bronchitis virus IBV are in the same antigenic group the S gene nucleotide sequence of TCoV only share 30 40 homology to that of IBV Lin et al 2004 The amino terminal S1 region of several coronaviruses has been reported to contain the receptor binding domain It can bind to cellular recep tors induce neutralizing antibodies and determine host specificity and tropism Hwang et al 2006 Sheahan et al 2008 The car boxyl induce et different of al isolates virus immunoperoxidase merase al system propagation sive methods sensitivity available sensitivity and et can bined increase PCR accessed standard tion feline tory et PCR risks be sitive quantitate 2 2 1 of Washington turkeys floor for study Committee 2 2 intestines enteritis 5 fold trifugation and 0 22H9262m membrane filters Millipore Products Division Bed ford MA respectively Twenty two days old embryonated turkey eggs were inoculated with 200H9262l of the filtrate via amniotic route and embryo intestines were harvested after 3 days of incubation Harvested embryo intestines were processed and propagated as described above for 5 passages Intestines of TCoV infected turkey embryos in the fifth passage were prepared as 20 suspension in PBS The suspension was homogenized clarified filtered as terminal S2 region consisting of transmembrane domain can cell fusion and viral assembly Broer et al 2006 Howard al 2008 The S2 gene is more conserved than S1 gene between coronaviruses and between different strains or isolates the same coronavirus Cavanagh 2005 Lin et al 2004 Loa et 2006a b Therefore S2 gene is a better target to detect TCoV and differentiate TCoV from other coronaviruses Conventional diagnostic methods for detecting TCoV include isolation VI immunofluorescent antibody assay IFA assay IP and reverse transcriptase poly chain reaction RT PCR Breslin et al 2000 Sekiguchi et 2004 Spackman et al 2005 Because there is no cell culture for TCoV the virus isolation has to use turkey eggs for of the virus which is time consuming and labor inten Immunofluorescent antibody assay and IP are antibody based They are simpler and faster than virus isolation but the is very low Since the sequence information of TCoV was RT PCRhasbeendevelopedandithashighspecificityand It has been applied to detect TCoV RNA in fecal samples intestinal contents of infected turkeys Breslin et al 2000 Loa al 2006a Nevertheless none of the above mentioned methods rapidly differentiate and quantitate TCoV Real time RT PCR RRT PCR uses a dual labeled probe com with the 5 prime 3 prime exonuclease activity of Taq polymerase to thereleaseofreporterdyefluorescenceinthecourseofthe amplification Holland et al 1991 Quantitative data can be by the standard curve established with serial dilutions of RNA This method has been applied to quantitative detec of many coronaviruses including canine coronavirus CCov infectious peritonitis virus FIPV and severe acute respira syndromes coronavirus SARS CoV Decaro et al 2004 Gut al 1999 Hui et al 2004 The procedure dose not need post electrophoresis so the processing time can be saved and the for carry over and cross contamination between samples can lessen The purpose of the present study was to develop a sen and specific one step RRT PCR to detect differentiate and TCoV RNA in the feces and tissues Material and methods Turkey eggs and poults Turkey eggs and 1 day old turkey poults British United Turkey America BUTA of both sexes were obtained from Perdue Farm IN USA They were free of recognized pathogens for including TCoV Turkey poults were housed in the isolated pens Feed and water were provided ad libitum The protocol care and use of turkey eggs and turkey poults in the present was approved by Purdue University Animal Care and Use Viruses Turkey coronavirus TCoV isolate 540 was isolated from the of 28 day old turkey poults with outbreaks of acute in Indiana Affected intestines were homogenized with volume of phosphate buffered saline PBS clarified by cen at 3000 g for 10min at 4 C and filtered through 0 45 described above and used as inoculum The titer of virus in the inoculum was determined by inoculation of the suspension at 10 fold dilutions into groups of five 22 day old embryonated turkey eggs The 50 embryo infectious dose EID 50 was calculated by the method of Reed and Muench Loa et al 2001 Reed and Muench 1938 Senne 2008 An inoculum containing 100 EID 50 200H9262lwas prepared and used to infect experimentally turkey poults 2 3 Primers and probe A forward primer QS1F 5 prime TCGCAATCTATGCGATATG 3 prime a reverse primer QS1R 5 prime CAGTCTTGGGCATTACA C 3 prime and a TaqMan dual labeled probe QS1P 5 prime AbsoluteQuencher TCTGTGGCAATGGTAGCCATGTTC FAM 3 prime were designed to amplify and detect 186 base pair fragment of the S2 gene of the TCoV isolate 540 The primers and probe were synthesized by Integrated DNA Technologies Coralville IA USA 2 4 RNA extraction The starting material consisted of 100mg of feces from the cloa cal swab samples or 100mg of feces from the floor was mixed with 500H9262l of PBS solution The mixture was centrifugated at 3000rpm for 2min and 140H9262l of supernatant was subjected to RNA extrac tion by using QIAamp viral RNA mini kit Qiagen Valencia CA USA For intestine tissue samples 40mg of tissue was weighted and mixed with lysis solution for further homogenization RNA was extracted from the homogenate with the Vergene tissue RNA purification kit Gentra Minneapolis MN USA following the man ufacturer s instruction 2 5 Real time RT PCR for TCoV A total 25H9262l of reaction mixture contained 900nM of forward primer QS1F 300nM of reverse primer QS1R 200nM of probe QS1P 12 5H9262l of Platinum Quantitative RT PCR ThermoScript TM One StepSystem2xreactionmix 0 5H9262lofSuperScript TM IIIreverse transcriptase Platinum Taq polymerase mix Invitrogen Carlsbad CA USA and 5H9262l of RNA template The reaction was carried out in Rotor Gene 3000 TM real time thermocycler Corbett Research Sydney Australia at 50 C for 30min 94 C for 5min and 45 cycles of 94 C for 20s and 61 C for 1min to acquire the fluorescence FAM Signals were regarded as positive if the fluorescence intensity exceeded 10 times the standard deviation of the baseline fluores cence 2 6 Specificity of RRT PCR for TCoV RNA of Salmonella Escherichia coli avian reovirus turkey herpesvirus avian influenza virus Newcastle disease virus enterovirus rotavirus transmissible gastroenteritis virus TGEV infectiousfelineperitonitisvirus FIPV caninecoronavirus CCoV bovine coronavirus BCoV infectious bronchitis virus IBV strain Ark99 IBV strain Connecticut IBV strain M41 TCoV isolate 517 TCoV isolate 540 TCoV isolate ATCC TCoV isolate 310 TCoV iso late 1440 and TCoV isolate 428 were extracted by the Vergene tissue RNA purification kit Gentra The extracted RNA was used in RRT PCR with primers QS1F and QS1R and the probe QS1P In 454 Y N Chen et al Journal of Virological Methods 163 2010 452 458 addition the amplicons of RRT PCR were electrophoresed on 1 agarose gel 2 7 Sensitivity and standard curve of RRT PCR for TCoV The carboxyl S gene segment of TCoV isolate 540 encompass ing the fragment targeted by the primers QS1F and QS1R was amplified by forward primer 6F 5 prime GACCATGGGATT TGTTGAA 3 constructed designed tive were tion transcripts and spectrophotometer tions analyzed lish for Ct mula copies 2 8 control Turkeys 540 3 day sue sample turkeys Cloacal everyday the of fecal DPI fecal 2 9 medium fixed turkey for incubated anti turkey perature dried ing CA Optiphot 2 2 10 One way TCoV tigate intestinalfragmentsatdifferenttimepoints Statisticalsignificance was set at p 0 05 3 Results 3 1 Specificity of RRT PCR for TCoV Primers QS1F and QS1R were highly specific to TCoV and con prime and reverse primer 6R 5 prime TTTTTAATGGCATCTTTTGA 3 prime and into pTriEx3 vector Novagen San Diego CA USA as pTriEx3 6F 6R To obtain a standard for quantita RRT PCR for TCoV the in vitro transcripts of pTriEx3 6F 6R generated by using RiboMAXTM large scale RNA produc system T7 Promega Madison WI USA The pTriEx 6F 6R were treated with DNase purified by Zymo DNA clean concentrate kit Zymo Orange CA USA and quantified by at 260nm wavelength Ten fold serial dilu of the RNA transcripts were made in RNase free water and byRRT PCRwiththeproceduresdescribedabovetoestab standard curve for quantification and determine the limit detection The standard curves were created by plotting the value against each dilution of known concentration The for used to calculate the copy numbers per H9262l is as followed H9262l ng H9262l 10 9 MW of transcript 6 023 10 23 Experimental infections of turkeys with TCoV In trial 1 there were 14 nine day old turkeys in the negative group and 21 turkeys in the experimentally infected group were inoculated orally with 100 EID 50 of TCoV isolate Duodenum jejunum ileum and cecum from 2 control and infected turkeys were collected at 12h post inoculation HPI 1 post inoculation DPI 2DPI 3DPI 5DPI 7DPI and14DPI Tis samples were frozen for IFA and RNA was extracted from each for quantitative RRT PCR for TCoV In trial 2 3 nine day old were inoculated orally with 100 EID 50 of TCoV isolate 540 fecal sample was collected in the swab from each turkey from 1 to 14 DPI In trial 3 3 nine day old turkeys were in negativecontrolgroupand3turkeysinoculatedwith100EID 50 TCoV isolate 540 were in the experimentally infected group The droppings on the floor were collected everyday from 1 to 14 and stored frozen until analyzed RNA was extracted from each swab or dropping sample for quantitative RRT PCR for TCoV Immunofluorescence antibody assay Frozen intestinal samples were embedded in the embedding and sectioned at 20 C Frozen intestinal sections were in acetone for 10min and incubated subsequentially with anti TCoV antiserum 1 40 dilution at room temperature 1h After washing with PBS for 10min the sections were with fluorescein isothiocyanate FITC conjugated goat IgG H L KPL Gaithersburg MA USA at room tem in dark for 1h Slides were washed in PBS for 10min air and mounted by the cover glasses in Vectashield mount medium for fluorescence Vector Laboratories Burlingame USA The slides were examined by a fluorescent microscope Nikon Melville NY USA Statistical analysis SPSS 15 0 SPSS Inc Chicago IL was used to analyze the data ANOVA was employed to evaluate the concentration of intheintestinalsamples Tukeytestwasfurtherusedtoinves the relationships between TCoV level measured in different served among known TCoV isolates Fig 1 Expected 186 bp band was amplified from TCoV RNA of TCoV isolates used in the present study including Indiana TCoV isolates 517 and 540 Minnesota TCoV isolates ATCC and 310 North Carolina TCoV isolate 1440 and Arkansas TCoV isolate 428 No bands of the expected size were amplified from the other coronaviruses CCoV BCoV TGEV FIPV IBV Ark99 IBV Connecticut IBV M41 enteric bacteria Salmonella and E coli and avian viruses avian influenza virus Newcastle disease virus avian reovirus turkey herpesvirus enterovirus and rotavirus 3 2 Sensitivity and detection limit Alinearstandardcurveoftemplatecopynumberagainstthresh oldcycletime Ct valuewasestablishedusingserial10 folddiluted pTriEx3 6F 6R RNA transcripts The coefficient of linear regression R 2 for the standard curve was 0 995 and the linear range was between 10 2 and 10 10 copies H9262l Fig 2 The detection limit was as low as 10 2 copies H9262l 3 3 TCoV in intestinal samples from experimentally infected turkeys For a total 84 intestinal samples from turkeys infected exper imentally with TCoV collected at 7 time points Seventy seven segments were detected positive for TCoV by RRT PCR The results of 51 samples were in agreement by both RRT PCR and IFA assays 45 positive and 6 negative for TCoV Fig 3 The 6 samples tested negative for TCoV by both assays were collected at 12h and 1 day post inoculation Regarding the TCoV level measured by RRT PCR TCoV can be detected as early as 12 HPI Fig 4 The highest concentration 5 10 15 copies H9262l was detected in jejunum at 5 DPI Except in duodenum showing the highest TCoV level at 1 DPI the highest concentration of TCoV in jejunum ileum or cecum was measured at 5 DPI The TCoV concentration was significantly lower in duo denum than that in the other 3 intestinal segments at 3 5 and 7 DPI p 0 05 The TCoV level was significantly higher in ileum than that in the other 3 intestinal segments at 3 and 14 DPI p 0 05 Greater variation in the results of RRT PCR and IFA was seen in the tissue samples collected at early time points when there was lower TCoV concentration in the sample 3 4 TCoV in cloacal fecal swabs from experimentally infected turkeys TCoV was detected in cloacal fecal swabs collected daily 1 14 DPI from the same 3 turkeys inoculated with TCoV Higher lev els of TCoV in the fecal cloacal swabs were detected in 3 turkeys at 1 and 7 DPI respectively The highest concentration of TCoV 2 88 10 10 copies H9262l was seen on day 1 The kinetics of the viral load from each turkey based on the TCoV level in the fecal sample from 1 to 14 DPI is shown in Fig 5 3 5 TCoV in fecal droppings from experimentally infected turkeys The TCoV levels of the fecal droppings on the floor assayed by RRT PCR ranged from 10 4 to 2 8 10 6 copies H9262lfrom1to14DPI Y N Chen et al Journal of Virological Methods 163 2010 452 458 455 Fig 1 Specificity of real time RT PCR RRT PCR for turkey coronavirus TCoV A The products on RNA extracted from TCoV isolate 517 540 ATCC 310 1440 and 428 are shown in 1 agarose Invitrogen Carlsbad CA USA and lane 2 is RNA in vitro transcribed from plasmid pTriEx3 6F 6R extracted from TCoV isolate 540 canine coronavirus CCoV bovine coronavirus BCoV infectious bronchitis virus IBV Ark99 IBV Conn and IBV M41 are shown on 1 agarose of RRT PCR performed on RNA extracted from Salmonella Escherichia coli avian influenza rotavirus are shown on 1 agarose gel from lanes 1 to 8 respectively Lane 9 is 100 bp DNA Fig 2 Standard curve of real time RT PCR RRT PCR assay for turkey coronavirus TCoV The X axis shows the concentration of serially diluted RNA in vitro tran scribed from standard pTriEx3 6F 6R in log10 value and the Y axis indicates the corresponding threshold cycle Ct value The linear quantitative correlation was established from 10 2 to 10 10 copies H9262l with 99 8 coefficient The detection limit is as low as 10 2 copies H9262l Fig 3 Detection of turkey coronavirus TCoV in the intestinal tissue samples from experimentally infected turkeys in the trial 1 The results by immunofluorescent antibody assay IFA are compared to those by real time RT PCR RRT PCR The numbers indicate the numbers of samples positive or negative for TCoV of RRT PCR with the primers QS1F and QS1R and the probe QS1P performed gel from lanes 3 to 8 respectively Lane 1 is DNA marker 100 base pair bp as the positive control B The products of RRT PCR performed on RNA transmissible gastroenteritis virus TGEV feline infectious peritonitis virus FIPV gel from lane