《【病毒外文文獻(xiàn)】2004 Respiratory and fecal shedding of Porcine respiratory coronavirus (PRCV) in sentinel weaned pigs and sequence of th》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2004 Respiratory and fecal shedding of Porcine respiratory coronavirus (PRCV) in sentinel weaned pigs and sequence of th（13頁珍藏版）》請?jiān)谘b配圖網(wǎng)上搜索。

Arch Virol 2004 149 957 974 DOI 10 1007 s00705 003 0245 z Respiratory and fecal shedding of Porcine respiratory coronavirus PRCV in sentinel weaned pigs and sequence of the partial S gene of the PRCV isolates V Costantini 1 P Lewis 1 J Alsop 2 C Templeton 2 and L J Saif 1 1 Food Animal Health Research Program Department of Veterinary Preventive Medicine Ohio Agricultural Research and Development Center The Ohio State University Wooster Ohio U S A 2 Animal Health Laboratory Guelph Ontario Canada Received July 25 2003 accepted September 29 2003 Published online November 26 2003 c Springer Verlag 2003 Summary Porcine respiratory coronavirus PRCV a spike S gene deletion mutant of Transmissible gastroenteritis virus TGEV causes mild or subclinical respiratory infections in pigs The shedding of PRCV TGEV was studied at different days post arrival in fecal and nasal swabs from PRCV TGEV seroneg ative sentinel pigs introduced into a PRCV seropositive herd with questionable TGEV serology and diarrhea Nasal shedding of PRCV was detected in 57 and 63 of samples by nested RT PCR and cell culture immunofluorescence CCIF respectively However fecal shedding of PRCV was detected in 37 of the samples by nested RT PCR and 19 by CCIF Four respiratory and 5 fecal PRCV strains were isolated in swine testicle cells including nasal fecal PRCV pairs isolated at the same time from 3 pigs Comparison of nasal fecal PRCV pairs from individual pigs revealed different deletions in the spike S gene 648 or 681 nt in 2 pairs and a consistent change in nt 790 791 aa T to V for all pairs In preliminary studies inoculation of gnotobiotic pigs with each plaque purified pair of the nasal and fecal PRCV isolates revealed no clinical disease but different tropisms The nasal isolate was shed both nasally and in feces but the fecal isolate was shed only marginally in feces and not nasally Our results show that nested RT PCR was as sensitive as CCIF for PRCV detection in nasal swabs but was more sensitive than CCIF for PRCV detection in fecal samples alternatively PRCV shed in feces was more labile with loss of infectivity The S gene sequence differences found between the fecal and respiratory PRCV isolates may influence their tissue tropism These new PRCV isolates should be useful to understand the molecular basis of coronavirus tropism and evolution in infected swine 958 V Costantini et al Introduction Porcine respiratory coronavirus PRCV is a deletion mutant ofTransmissiblegas troenteritis coronavirus TGEV with altered respiratory tissue tropism 13 17 Transmissible gastroenteritis virus causes fatal diarrhea in neonatal piglets It selectively infects and replicates in the villous enterocytes of the small intestine causing subsequent malabsortion and dehydration characteristic of transmissi ble gastroenteritis TGE 17 Transmissible gastroenteritis virus has also been shown to replicate in the upper respiratory tract tissue of infected swine 12 13 Porcine respiratory coronavirus is genetically and antigenically related to TGEV but it has a selective tropism for respiratory tissue causing mild or sub clinical respiratory infections with limited to no replication in the intestinal tissue of infected swine 16 13 7 17 During routine serological surveillance of pig herds in Great Britain Belgium Holland and France in the 1980s an increase in the number of herds with antibodies to TGEV was noted but without concomitant increases in clinical enteric disease A coronavirus PRCV was isolated in 1983 from respiratory tissues of affected pigs in Belgium 16 Great Britain 3 and later in other parts of Europe Several years later another strain PRCV Ind89 was isolated from pigs in the U S 28 Both TGEV and PRCV contain a single stranded positive sense RNA genome of about 30 kb and produce 7 8 subgenomic mRNAs during viral replication The 3 major structural proteins the spike S the integral membrane M gly coprotein and the nucleocapsid N protein are translated from mRNAs 2 5 and 6 respectively The mRNAs 3 3 1 or 3a 3b encode two putative nonstructural proteins 13 25 Comparison of TGEV and PRCV strains revealed that PRCV has a large deletion in the 5 prime region of the S gene and minor deletions in genes 3 3a and 3 1 3b 13 25 Most European PRCVs have an identical deletion of 672 nt in the same position at the 5 prime end region suggesting that they were derived from the same precursor 20 In contrast U S PRCV strains have deletions of various sizes 621 681 nt located in different positions suggesting that they originated independently 6 Because this deletion is present in all independently derived PRCVs it has been proposed that the size and position of the deletion is related to the differences observed in tissue tropism between PRCV and TGEV 1 8 In vestigators have suggested that amino acid changes at the N terminal region of the TGEV S protein also affect the enteric tropism of the PUR46 strain of TGEV 1 The S protein has a glycosylated membrane anchoring domain and is thought to be the viral attachment protein that interacts with the cell receptor porcine aminopeptidase N APN 21 11 However a second region in the S protein around amino acid 219 also influences the enteric tropism of TGEV 1 The S protein of TGEV has four major antigenic sites with siteA being the major inducer of neutralizing antibodies and conserved in both TGEV and PRCV strains 5 19 The S protein of PRCV is smaller due to the deletion with loss of one or two antigenic sites C and B or D depending on the nomenclature in the deletion region 19 11 Because most virus neutralization VN antibodies are directed to Respiratory and fecal shedding of PRCV 959 siteA conventional antibody assays fail to differentiate between pigs infected with PRCV or TGEV Blocking ELISA tests using monoclonal antibodies to antigenic sites in the PRCV deletion region of the S protein one to conserved site A and a second to deleted site D are used to serologically differentiate between PRCV and TGEV infected pigs 17 23 24 Because site A is conserved on TGEV and PRCV only sera from pigs infected with either virus will contain antibodies to this site and compete with site A MAbs for binding to the viral protein in blocking ELISA In contrast because site D is only present on TGEV but absent on PRCV sera from pigs infected with TGEV compete with site D MAbs 23 24 However sometimes these tests result in false TGEV positives or borderline reactions that are difficult to interpret making it problematic to accurately define the TGEV status or diagnose TGEV in PRCV infected swine herds 22 We investigated the shedding of PRCV TGEV in PRCV TGEV seronegative sentinel pigs introduced into a PRCV seropositive herd with questionable TGEV serology and diarrhea of uncertain etiology in weaning pigs Our objectives were to isolate and characterizate TGEV or PRCV strains from this field outbreak and to determine their genetic relationships to one another and to reference strains Because previous studies have suggested that the S gene deletion area may influence viral tissue tropism we focused on analysis of this region 1 26 These new PRCV isolates derived from both nasal swabs and feces should serve as tools to gain a better understanding of the molecular basis and evolution of the pathogenesis of coronaviruses Materials and methods Experimental design We attempted to isolate and characterize TGEV and PRCV strains from a PRCV seropositive herd in Canada with questionable TGEV serology inconclusive results in blocking ELISA SVANOVIR Uppsala Sweden and diarrhea of uncertain etiology Thirty one PRCV TGEV seronegative weaned sentinel pigs were introduced into the herd The herd was a 300 sow farrow to finish unit The average inventory was 400 nursing piglets 900 nursery weaned pigs and 1800 grow finish pigs The sentinel pigs were all placed in one room and then dispersed among 8 pens with 3 or 4 sentinel pigs in each pen in addition to 23 25 recently weaned resident pigs The average weaning age in the herd was 19 days and the sentinel pigs were 2 3 weeks old when introduced Source herd samples and cells We investigated the shedding of PRCV TGEV in sentinel pigs introduced into the herd Although resident pigs consistently tested positive for serum antibodies to PRCV in a com mercial blocking ELISA test occasionally some pigs also tested TGEV seropositive in this test suggesting the presence of false positives or TGEV cases in the weaning pigs with diarrhea In an attempt to isolate and characterize TGEV and PRCV strains from this herd fecal and nasal swabs were collected from 16 of the 31 sentinel pigs at 5 8 19 and 23 days post arrival DPA A total of 54 nasal swabs and 57 fecal samples were collected with 51 nasal swabs and fecal sample pairs collected concurrently and tested by nested RT PCR and cell culture immunofluorescence CCIF to detect PRCV or TGEV Each swab was identified 960 V Costantini et al as follows pig number DPA origin fecal F or nasal N sample For example 12 19F pig 12 19 DPA fecal sample Fig 2 Four respiratory nasal and 5 enteric fecal PRCV strains but no TGEV strains were isolated The designation of PRCV was based on the presence of the typical 5 prime S gene deletion in all the isolates described in a subsequent section The swine testicle cells were used for virus isolation propagation and cell culture immunofluorescence tests CCIF as previously described 10 Each strain was isolated and plaque purified once or twice in swine testicle ST cells Nested reverse transcriptase polymerase chain reaction Fecal and nasal swabs from the field cases sentinel pigs cell culture isolates and fecal and nasal swabs from gnotobiotic pigs were tested by nested RT PCR to detect and to differenti ate TGEV and PRCV viral RNA as previously described by Kim et al 9 The RT PCR primers F1 5 prime GGGTAAGTTGCTCATTAGAAATAATGG 3 prime and R1 5 prime CTTCTTCAA AGCTAGGGACTG 3 prime and the Nested PCR primers F2 5 prime TTGTGGTYTTGGTYGTAA TKCC 3 prime and R2 5 prime GGCTGTTTGGTAACTAATTTRCCA 3 prime associated with the open reading frame 1b and the S gene deletion area for U S and European strains of PRCV were used 9 The RNA from the fecal or nasal swabs or cell culture isolates were extracted using a commercial RNA extraction kit TRIZOL LS reagent Life Technology NY U S A according to the manufacturer s recommendation Briefly 200 l of the nasal or fecal swab fluids diluted in MEM E were mixed with 600 l of TRIZOL and were incubated for 5 min at room temperature Following incubation 160 l of chloroform were added The samples were incubated for 15 min at room temperature and centrifuged at 13 000 g for 15 min at 4 C The RNA was precipitated with isopropanol Purified RNA was resuspended in 40 l of DEPC water The reference strains ISU 1 PRCV and M6 Milller TGEV were used as positive controls and negative controls included MEM E or PRCV TGEV negative fecal or nasal swabs from unexposed gnotobiotic pigs Five l of RNA from the field samples positive and negative controls were mixed with the RT PCR reaction mixture which contained 5 lof10X PCR Buffer Promega Madison WI U S A 5 l of 25 mM MgCl 2 Promega Madison WI U S A 1 1 of 10 mM dNTPs 20 U Rnasin Promega Madison WI U S A 5 U AMV reverse transcriptase Promega Madison WI U S A 2 5 U of Taq DNA Polymerase Promega Madison WI U S A and 0 5 l of 50 pm of each primer F1 and R1 The samples were incubated at 42 C for 90 min followed by 95 C for 5 min The conditions for the first PCR were as follows 30 cycles of denaturation at 94 C for 1 min annealing at 60 C for 1 5 min and extension at 72 C for 2 5 min followed by a final cycle of extension at 72 C during 10 min The RT PCR products were diluted 1 10 and used as templates for the nested PCR One microliter of this diluted product was mixed with 5 l of 10X PCR buffer Promega Madison WI U S A 5 l of 25 mM MgCl 2 Promega Madison WI U S A 1 l of 10 mM dNTPs 2 5 U of Taq DNA Polymerase Promega Madison WI U S A and 0 5 l of 50 pm of each primer F2 and R2 The conditions for the Nested PCR were as follows 30 cycles of denaturation at 94 C for 1 min annealing at 62 C for 1 5 min and extension at 72 C for 2 5 min followed by a final cycle of extension at 72 C for 10 min PCR products were analyzed on 1 5 agarose gels stained with ethidium bromide 9 15 25 The predicted size of the amplified product was 874 bp for TGEV and 193 253 bp for PRCV 9 Cell culture immunofluorescence test CCIF Fecal and nasal swab supernatant fluids from the sentinel field cases or the cell culture passaged PRCV isolates and nasal and fecal swabs from gnotobiotic pigs were diluted in minimum essential medium MEM E and tested by CCIF to detect infectious virus using Respiratory and fecal shedding of PRCV 961 previously described procedures 23 Briefly 4 or 10 fold serial dilutions of the nasal and fecal swab supernatants or PRCV cell culture isolate respectively were inoculated onto ST cell monolayers in 96 well plates and incubated for 18 hours The cells were fixed with 80 acetone stained with hyperimmune porcine anti TGEV serum conjugated to fluorescein isothiocyanate and analyzed by fluorescent microscopy 9 Sequencing of the partial S gene of the isolated PRCV strains Four respiratory 7 19N 7 23N 12 19N 16 19N and 5 fecal 7 19F 12 19F 16 19F 14 23F 24 23F PRCV strains including the 3 pairs of nasal fecal samples from three pigs one day after diarrhea designated 7 19N 7 19F 12 19N 12 19F 16 19N 16 19F were isolated from the nasal and fecal swab fluids respectively of the sentinel pigs in contact with the resident pigs Each isolate was first passaged once or twice in ST cells and then plaque purified in ST cells Sequence analysis of the partial S gene of 7 19N 1 2 7 23N 2 1 12 19N 3 1 16 19N 2 1 7 19F 1 1 12 19F 2 1 16 19F 2 1 14 23F 1 1 24 23F 3 1 Number of times passaged in cell culture number of times plaque purified and reference strain ISU 1 was performed with primers F1 and R1 The RT PCR products were purified using a Geneclean spin kit Bio101 CA and sequenced by dideoxynucleotide chain termination procedures using an automated sequencer ABI 377 Perkin Elmer CA Sequence data were aligned using the DNAstar software program DNASTAR Madison WI and compared with the published sequence using the Clustal methods Double antibody sandwich ELISA DAS ELISA for the detection of TGEV PRCV antigen Rectal and nasal swab fluids collected from gnotobiotic pigs from 0 to 14 DPI were tested by DAS ELISA to detect virus antigen as described previously 14 Briefly ELISA plates were coated with the monoclonal antibody MAB 25C9 and 44C11 to the TGEV S protein and MAB 25H7 to the N protein positive coating or with negative ascites SP2 0 negative coating All samples were tested in duplicate wells one with positive and one with negative coating Viral antigen captured on the plate was detected with the purified biotinylated IgG fraction of a TGEV hyperimmune antiserum followed by streptavidin peroxidase and 2 2 prime Azino bis 3 ethylbenzthiazoline 6 sulfonic acid as substrate Gnotobiotic pig inoculation with the fecal and respiratory PRCV strains Two hysterectomy derived colostrum deprived 4 day old gnotobiotic pigs were oronasally inoculated with the cell culture adapted plaque purified 12 19N 3 1 PRCV isolate 4 10 7 plaque forming units PFU pig As a control a third gnotobiotic pig was oronasally inocu lated with MEM E Clinical parameters including diarrhea and fecal scores 0 normal 1 pasty 2 semiliquid 3 liquid were recorded Fecal and nasal shedding of viral RNA or virus were assayed by nested RT PCR CCIF and DAS ELISA 9 10 from days post inoculation DPI 1 to 14 One infected and one control pig were euthanized at 7 DPI and sections of duodenum jejunum ileum and lung were collected for immunofluorescence assay IFA and histopathology For IFA impression smears were made on glass microscope slides air dried fixed in acetone and stained with FITC conjugated anti TGEV serum For histopathology studies tissues were processed in Prefer fixative solution embedded in paraffin and stained with hematoxylin and eosin as previously described 10 2 In a second experimental group two hysterectomy derived colostrum deprived 25 day old gnotobiotic pigs were oronasally inoculated with either the cell culture adapted plaque purified 12 19F 2 1 PRCV isolate 1 10 7 plaque forming units PFU pig or with 5 ml of a 1 2 dilution of the pooled rectal swab fluids recovered DPI 1 5 from one of the initial 962 V Costantini et al gnotobiotic pigs inoculated with 12 19N 3 1 PRCV In addition a third gnotobiotic pig was oronasally inoculated with MEM E as a control Pigs were euthanized at 4 DPI and sections of duodenum jejunum ileum and lung were collected for IFA and histopathology Results The sentinel pigs remained PRCV TGEV seronegative at 0 and 14 DPA but developed diarrhea at 18 DPA and 17 31 55 seroconverted to PRCV but not TGEV detected by blocking ELISA at 28 DPA At 19 DPA one sentinel pig died but neither PRCV nor TGEV were detected in the tissues Nasal shedding of PRCV was detected in 57 31 54 of the samples by nested RT PCR and 63 34 54 of the samples by CCIF Thirteen percent 7 54 of the nasal samples were positive by nested RT PCR only and 18 10 54 of the nasal samples were positive by CCIF only However fecal shedding of PRCV was detected in 37 21 57 of the samples by nested RT PCR and only 19 11 57 of the samples by CCIF Twenty one percent 12 57 of the fecal samples were positive by nested RT PCR only and 4 2 57 were positive by CCIF only Virus isolation was successful from 14 34 41 CCIF positive nasal swabs and from 7 11 63 CCIF positive fecal samples The fecal and nasal shedding of PRCV at 5 8 19 and 23 DPA detected by nested RT PCR and CCIF are shown in Fig 1a and 1b The peak of PRCV nasal Fig 1a shedding was detected at 19 DPA 1 day after diarrhea outbreak by nested RT PCR 86 and CCIF 93 Both techniques showed similar sensitivity to detect PRCV in nasal swabs with the percentage of positive samples increasing until 19 DPA and decreasing at 23 DPA 5 days after diarrhea outbreak The peak of PRCV fecal shedding Fig 1b was also detected at 19 DPA 1 day after diarrhea outbreak by nested RT PCR 57 but at 5 DPA by CCIF 46 Nested RT PCR was more sensitive than CCIF for detecting PRCV in the fecal swabs Four respiratory and 5 fecal PRCV field strains were adapted to growth in ST cells and plaque purified The partial S gene of these 9 cell culture adapted plaque purified strains was sequenced Fig 2 The strains were assigned to 3 groups according to the size and position of the S gene deletion Fig 2 The Group 1 isolates 12 19F 2 1 and 16 19F 2 1 had a 648 nt deletion in the S gene starting from nt 106 to nt 753 The Group 2 isolates 7 19F 1 1 7 19N 1 2 14 23F 1 1 and 24 23F 3 1 had a 681 nt deletion starting from nt 64 to nt 744 and the Group 3 isolates 16 19N 2 1 12 19N 3 1 and 7 23N 2 1 had a 675 nt deletion starting from nt 58 to nt 732 Sequence analysis revealed that the selected region of the S gene of the PRCV field isolates had higher homology to U S PRCV strains than to European PRCV strains and the size and position of the deletion was similar to U S strains Analysis of the sequence of cell culture adapted plaque purified 7 19F 1 1 7 19N 1 2 12 19F 2 1 12 19N 3 1 and 16 19F 2 1 16 19N 2 1 each fecal nasal pair collected concurrently as nasal and fecal swabs of 3 different pigs showed 4 nt differences nt 51 790 791 and region 58 63 between the fecal and respiratory strains isolated from the same pig on the same day However only changes in nt Respiratory and fecal shedding of PRCV 963 Fig 1 a Nasal shedding of PRCV detected by nested R T PCR and CCIF b fecal shedding of PRCV detected by nested R T PCR and CCIF Diarrhea occurred among these pigs at day 18 964 V Costantini et al Fig 2 continued Respiratory and fecal shedding of PRCV 965 Fig 2 Nucleotide sequence of the fecal and nasal PRCV field isolates The nucleotide sequences were aligned by Clustal methods The