《【病毒外文文獻】2005 SARS coronavirus spike polypeptide DNA vaccine priming with recombinant spike polypeptide from Escherichia coli as》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻】2005 SARS coronavirus spike polypeptide DNA vaccine priming with recombinant spike polypeptide from Escherichia coli as（10頁珍藏版）》請在裝配圖網(wǎng)上搜索。

Abstract SARS CoV spik DN S peptide primed i p tP groups DN oral peptide of S peptide ci systems 1 countries 750 0264 410X doi 10 1016 j v Vaccine 23 2005 4959 4968 SARS coronavirus spike polypeptide DNA vaccine priming with recombinant spike polypeptide from Escherichia coli as booster induces high titer of neutralizing antibody against SARS coronavirus Patrick C Y Woo a b c Susanna K P Lau a b c Hoi wah Tsoi a Zhi wei Chen d Beatrice H L Wong a Linqi Zhang d Jim K H Chan a Lei po Wong a Wei He e Chi Ma e Kwok hung Chan a b c David D Ho d Kwok yung Yuen a b c a Department of Microbiology The University of Hong Kong Room 423 University Pathology Building Queen Mary Hospital Hong Kong b Research Centre of Infection and Immunology Faculty of Medicine Hong Kong c State Key Laboratory for Emerging Infectious Diseases The University of Hong Kong Hong Kong d Aaron Diamond AIDS Research Center NY USA e Peking Union Medical College Beijing China Received 30 December 2004 received in revised form 19 May 2005 accepted 29 May 2005 Available online 13 June 2005 Different forms of SARS coronavirus SARS CoV spike protein based vaccines for generation of neutralizing antibody response against were compared using a mouse model High IgG levels were detected in mice immunized with intraperitoneal i p recombinant e polypeptide generated by Escherichia coli S peptide mice primed with intramuscular i m tPA optimize800 DNA vaccine tPA S A and boosted with i p S peptide mice primed with i m CTLA4HingeSARS800 DNA vaccine CTLA4 S DNA and boosted with i p mice primed with oral live attenuated Salmonella typhimurium with oral live attenuated S typhimurium that contained tPA optimize800 S peptide and mice primed with oral live attenuated S typhimurium A S DNA and boosted with i p S peptide No statistical significant dif of mice with high IgG levels Sera of all six mice immunized with A control showed no neutralizing antibody against SARS CoV Sera of Salmonella S DNA control boosted with i p S peptide oral Salmonella oral Salmonella CTLA4 S DNA and oral Salmonella CTLA4 S DN 1 20 1 160 Sera of all the mice immunized with i m tPA S DNA boosted showed neutralizing antibody titers of 1 1280 The present observ vet cats since production of recombinant proteins from E coli is far less e 2005 Elsevier Ltd All rights reserved Introduction Severe acute respiratory syndrome SARS has affected 30 in five continents with more than 8000 cases and deaths A novel virus the SARS coronavirus SARS Corresponding author Tel 852 28554892 fax 852 28551241 E mail address hkumicro hkucc hku hk K Yuen CoV In CoV animal implied of spik see front matter 2005 Elsevier Ltd All rights reserved accine 2005 05 023 Salmonella S DNA control and boosted with i p S peptide mice DNA vaccine Salmonella tPA S DNA and boosted with that contained CTLA4HingeSARS800 DNA vaccine Salmonella ference was observed among the Th1 Th2 index among these six i p S peptide i m DNA vaccine control and oral Salmonella S the mice immunized with i m tPA S DNA i m CTLA4 S DNA tPA S DNA oral Salmonella tPA S DNA boosted with i p S A boosted with i p S peptide showed neutralizing antibody titers with i p S peptide and i m CTLA4 S DNA boosted with i p ation may have major practical value such as immunization of xpensive than production of recombinant proteins using eukaryotic has been confirmed to be the etiological agent 1 7 addition we have also reported the isolation of SARS like viruses from Himalayan palm civets found in a live market in the Guangdong Province of China which that animals could be the reservoir for the ancestor SARS CoV 8 In animal coronavirus infections it has been shown that the e proteins of coronaviruses were highly immunogenic 4960 23 and v were responding been gene responsible angiotensin con also antibody 3 10 11 is studies cell infection administered ferring to against appeared produce whereas Esc protecti eukaryotic Ho tered the may e follo by a CoV tralizing mouse polypeptide of without produced spik recombinant are 2 2 1 used under perature w 2 2 fr SARS CoV a GGA 5 3 residues by because the complete The sites resultant which 250 667 v do His w Chelating to 2 3 vaccines P C Y Woo et al Vaccine immunization of animals using spike protein based accines were able to produce neutralizing antibodies that effective in prevention of infections caused by the cor coronaviruses For SARS CoV infection it has shown that nucleotides 952 1530 of the spike protein of SARS CoV encoded a 193 amino acid fragment for attaching to the receptor for SARS CoV verting enzyme 2 9 Furthermore we and others have shown that patients with SARS produced response against the spike protein of SARS CoV and it has been demonstrated that the spike protein the major target for passive immunization 12 13 In that determine the relative importance of humoral and mediated immunity for protection against SARS CoV it was confirmed that neutralizing antibody when by passive immunization was crucial in con protection 14 whereas T cell immunity was unable lead to protection 15 In addition for vaccine candidates SARS CoV spike protein based DNA vaccines to be a promising group of vaccine shown to protective immunity against SARS CoV infections recombinant spike protein vaccines produced by herichia coli were not efficient in terms of generation of ve immunity as compared to those generated from systems such as transfection of cell lines 14 25 wever multiple doses of intramuscularly i m adminis DNA vaccine or recombinant protein generated from eukaryotic systems are quite expensive and therefore not be practical in developing countries No data on less xpensive modalities of immunization such as DNA vaccine wed by boosters of recombinant vaccine produced E coli or oral mucosal DNA vaccines 26 29 are vailable In this study we compared the different forms of SARS spike protein based vaccines for generation of neu antibody response against SARS CoV using a model The relative effectiveness of recombinant spike vaccine produced by E coli two different types intramuscular spike polypeptide DNA vaccine with and boosters of recombinant spike polypeptide vaccine by E coli and two different types of oral mucosal e polypeptide DNA vaccine with and without boosters of spike polypeptide vaccine produced by E coli compared Materials and methods Animals Male Balb c H 2 d mice 6 8 weeks old 18 22 g were in all animal experiments They were housed in cages standard conditions with regulated day length tem and humidity and were given pelleted food and tap ater ad libitum human optimize800 CTLA4 S DN human Multi according polypeptides 2 4 CTLA4Hing CTLA4HingeSARS800 S DN according and typhimurium deri from 2 5 CTLA4Hing S DN tocol 2005 4959 4968 Recombinant SARS CoV spike polypeptide vaccine om E coli Cloning and purification of the spike polypeptide of was reported previously 3 Briefly to produce plasmid for protein expression primers LPW742 5 prime CGC TCCGAGTGACCTTGACCGGTGC 3 prime and LPW931 prime CGGGGTACCTTAACGTAATAAAGAAACTGTATG prime were used to amplify the gene encoding amino acid 14 667 of the spike protein of the SARS CoV RT PCR This portion of the spike protein was used it contains the receptor binding domain within S1 domain that is highly immunogenic whereas the spike protein was not expressible in E coli PCR product was cloned into the BamHI and KpnI of vector pQE 31 Qiagen Hilden Germany The clone was digested by PstI and the PstI fragment contained the gene encoding amino acid residues of the spike protein was cloned into expression ector pQE 30 Qiagen Hilden Germany in frame and wnstream of the series of six histidine residues The 6 tagged recombinant spike polypeptide S peptide as expressed and purified using the Ni 2 loaded HiTrap System Amersham Pharmacia USA according the manufacturer s instructions Human codon usage optimized SARS CoV DNA To enhance the expression of spike polypeptide in cells the two SARS CoV DNA vaccines tPA tPA S DNA and CTLA4HingeSARS800 A were constructed using the concept of codon usage optimization 30 with QUIKChange Site Directed Mutagenesis Kit Strategene USA to manufacturer s instructions The synthetic were cloned into pcDNA3 1 Oral mucosal tPA optimize800 and eSARS800 DNA vaccines The oral mucosal tPA optimize800 and DNA vaccines Salmonella tPA A and Salmonella CTLA4 S DNA were prepared to our published protocol 26 29 tPA S DNA CTLA4 S DNA were transformed into auxotrophic S aroA strain SL7207 S typhimurium 2337 65 vative hisG46 DEL 407 aroA Tn10 Tc s a gift Dr Bruce Stocker 31 by electroporation Transfection of 293 cells with tPA optimize800 and eSARS800 Transfection of 293 cells with tPA S DNA and CTLA4 A was performed according to our published pro 26 29 Two hundred and ninety three cells were 23 2005 4959 4968 4961 plated Eagle serum tion with CoV pcDN Boehringer turer cells times w by hyperimmune S peptide 2 6 published 293 tP into polyacrylamide nitrocellulose The pre immune from interaction system UK 2 7 e T intraperitoneally Group i m per immunized 3 5 tw 0 5 mice strain per 6 or per of i p T dose Third dose Routes days of administration Dose per mouse V accines Routes days of administration Dose per mouse polypeptide Intraperitoneal 14 50 H9262 g Spik e polypeptide Intraperitoneal 28 50 H9262 g polypeptide Intraperitoneal 28 50 H9262 g Spik e polypeptide Intraperitoneal 42 50 H9262 g polypeptide Intraperitoneal 28 50 H9262 g Spik e polypeptide Intraperitoneal 42 50 H9262 g polypeptide Intraperitoneal 28 50 H9262 g Spik e polypeptide Intraperitoneal 42 50 H9262 g polypeptide Intraperitoneal 28 50 H9262 g Spik e polypeptide Intraperitoneal 42 50 H9262 g polypeptide Intraperitoneal 28 50 H9262 g Spik e polypeptide Intraperitoneal 42 50 H9262 g P C Y Woo et al Vaccine at 1 10 7 cells per well in Dulbecco s modified s medium GibcoBRL USA with 10 fetal calf FCS in a six well plate on the day before transfec On the day of transfection each well was transfected 1H9262g plasmid encoding eukaryotically expressed SARS spike polypeptide tPA S DNA or CTLA4 S DNA or A3 1 S DNA control with FuGENE 6 Reagent Mannhein Germany according to manufac s instructions Forty eight hours after transfection the were harvested and lysed by freezing and thawing three After centrifugation at 14000 rpm the supernatant as used for the detection of SARS CoV spike polypeptide Western blot assay using pre immune rabbit serum and polyclonal serum from rabbit immunized with Western blot analysis Western blot analysis was performed according to our protocol 29 Briefly 10H9262l of supernatant of cell lysates obtained from 293 cells transfected with A S DNA CTLA4 S DNA or S DNA control was loaded each well of a sodium dodecyl sulfate SDS 8 gel and subsequently electroblotted onto a membrane Bio Rad Hercules CA USA blot was incubated separately with 1 1000 dilution of rabbit serum or hyperimmune polyclonal serum rabbit immunized with S peptide Antigen antibody was detected with an ECL fluorescence Amersham Life Science Buckinghamshire Immunization schedule Seventy two Balb c mice were used for the immunization xperiments The immunization schedule is summarized in able 1 On days 0 14 and 28 six mice were immunized i p with S peptide 0 5H9262g per mouse 1 Table 1 On day 0 six mice were immunized tibialis anterior muscle with S DNA control 100H9262g mouse Group 2 Table 1 and 12 mice each were i m with tPA S DNA 100H9262g per mouse Group Table 1 or CTLA4 S DNA 100H9262g per mouse Group Table 1 On days 28 and 42 6 of the 12 mice in the o DNA vaccine groups were boosted with i p S peptide H9262g per mouse Groups 4 and 6 Table 1 On day 0 12 each were immunized orally with S typhimurium aroA Salmonella S DNA control 6 10 9 bacterial cells mouse Group 7 Table 1 Salmonella tPA S DNA 10 9 bacterial cells per mouse Group 9 Table 1 Salmonella CTLA4 S DNA 6 10 9 bacterial cells mouse Group 11 Table 1 On days 28 and 42 6 the 12 mice in the three groups were boosted with S peptide 0 5H9262g per mouse Groups 8 10 and 12 able 1 T able 1 Immunization schedule for dif ferent forms of spik e polypeptide based v accines against SARS CoV Groups First dose day 0 Second V accines Routes of administration Dose per mouse V accines 1 Spik e polypeptide Intraperitoneal 50 H9262 g Spik e 2 pcDN A3 1 Intramuscular 100 H9262 g 3 t P A optimize800 DN A v accine Intramuscular 100 H9262 g 4 t P A optimize800 DN A v accine Intramuscular 100 H9262 g Spik e 5 CTLA4HingeSA RS800 DN A v accine Intramuscular 100 H9262 g 6 CTLA4HingeSA RS800 DN A v accine Intramuscular 100 H9262 g Spik e 7 S typhimurium aroA strain Oral 6 10 9 bacterial cells 8 S typhimurium aroA strain Oral 6 10 9 bacterial cells Spik e 9 Mucosal tP A optimize800 DN A v accine Oral 6 10 9 bacterial cells 10 Mucosal tP A optimize800 DN A v accine Oral 6 10 9 bacterial cells Spik e 11 Mucosal CTLA4HingeSA RS800DN A v accine Oral 6 10 9 bacterial cells 12 Mucosal CTLA4HingeSA RS800 DN A v accine Oral 6 10 9 bacterial cells Spik e 4962 23 2 8 SARS CoV nization corresponding for before measured ELISA cations 1 10 1 10 plates IgG2a plates w anti mouse and oratories instructions responding IgM and were inclined and times Laboratories room 0 3 each cate The the the ing inde IgG2a 2 9 published performed Containment ered MN type microtiter fold tested responding inoculation the of of to 2 10 LPI 29 the by resuspended MD into Cells per or at Amersham 1 glass using and counter LPI dif ne controls P C Y Woo et al Vaccine Measurement of serum antibodies against spike polypeptide Mice from each group were bled on the day before immu and 42 days after the last dose of vaccine in the group The blood was centrifuged at 2700 g 20 min and the supernatant serum was stored at 70 C antibody measurement Antibodies against SARS CoV spike polypeptide were using the enzyme linked immunosorbent assay according to our published protocol with modifi 3 4 Mouse sera diluted with PBS 2 skim milk for IgM 1 80 for IgG 1 1280 for IgG1 1 40 for IgG2a for IgG2b and 1 320 for IgG3 were added to ELISA precoated with S peptide 80 ng per well for IgM IgG IgG2b and IgG3 and 10 ng per well for IgG1 The were incubated at 37 C for 1 h After washing with ashing buffer five times 100H9262l peroxidase conjugated goat IgM and IgG rabbit anti mouse IgG1 IgG2a IgG3 and rat anti mouse IgG2b antibody Zymed Lab Inc USA diluted according to manufacturer s using PBS 2 skim milk were added to the cor wells accordingly and incubated at 37 C for 1 h and total IgG levels were assayed to assess the primary secondary immune response while the IgG subtypes used to determine whether the humoral response was towards the Th1 IgG2a and IgG2b or Th2 IgG1 IgG3 pattern After washing with washing buffer five 100H9262l diluted 3 3 prime 5 5 prime tetramethylbenzidine Zymed Inc was added to each well and incubated at temperature for 15 min One hundred microliters of M H 2 SO 4 was added and the absorbance at 450 nm of well was measured Each sample was tested in dupli and the mean absorbance for each serum was calculated serum antibody level of a particular mouse was defined as absorbance obtained from the serum taken 42 days after last dose of the vaccine minus that of the correspond mouse taken the day before immunization The Th1 Th2 x of each mouse is calculated by the following formula IgG2b IgG1 IgG3 Neutralizing antibody assay The neutralizing antibody assay was modified from our protocol 32 All work with infectious virus was inside a type II Biosafety Cabinet in a Biosafety level III facility and the personnel wore pow air purifying respirators HEPA Airmate 3M St Paul Initial screening of mouse sera against the proto SARS CoV strain no 39849 was performed in 96 well plates seeded with fetal rhesus kidney 4 cells Two dilutions of mouse sera from 1 20 to 1 1280 were in duplicate against 100 TCID 50 of SARS CoV A cor set of cell controls with sera but without virus was used as controls The cells were scored for inhibition of the cytopathic effect CPE at 48 h The titer 2 11 assays protocol group and 2 supplemented mercaptoethanol final 200 c or OptEIA dilutions were ing diluent three added at 100 and the w to 2005 4959 4968 neutralizing antibody is defined as the maximum dilution serum at which the percentage of CPE is less than or equal 50 Measurement of lymphocyte proliferation index LPI was measured according to our published protocol On day 60 single cell suspensions of spleen cells from six mice of each group were depleted of erythrocytes adding freshly prepared Gey s solution The cells were in RPMI 1640 medium Gibco BRL Rockville supplemented with 15 fetal calf serum and inoculated microwell plates at 5 10 5 cells per well in triplicate were stimulated with phytohaemagglutinin at 5H9262g well positive control S peptide at 0 1H9262g per well RPMI medium negative control Cells were cultured 37 C5 CO 2 for 3 days and 3 H labelled thymidine Pharmacia Little Chalfont UK was added at H9262Ci per well for the last 18 h Cells were harvested onto microfibre filter Whatman International Ltd UK a Model CH1 cell harvester Insel Hampshire UK radioactivity was measured by a liquid scintillation Beckman Fullerton CA The S peptide specific of a particular sample is defined as the ratio of the ference of radioactivity between the sample and the gative control and that between the positive and negative Interleukin 4 IL 4 and interferon IFN IL 4 and IFN H9253 were assayed according to our published 29 On day 60 spleens from the six mice in each were harvested Single cell suspensions were prepared cells from mice within the same group were pooled 10 6 cells were cultured in 1 ml RPMI 1640 medium with 10 fetal calf serum and 5 10 5 M2 in 24 well plates S peptide was added at concentrations of 0 5 1 0 and 2 5H9262g ml Supernatant H9262l from each sample was collected at 24 48 and 72 h for ytokine measurement Monoclonal antibodies against IL 4 IFN H9253 were coated onto wells in 96 well microtiter plates PharM3ingen Becton Dickinson USA at 1 250 according to manufacturer s instructions The plates incubated at RT for 24 h After washing with wash buffer three times the plates were blocked with assay at RT for 1 h After washing with washing buffer times 100H9262l of supernatant from each sample was to the wells in duplicate The plates were incubated RT for 2 h After washing with washing buffer five times H9262l diluted biotinylated antibody against IL 4 or IFN H9253 avidin horseradish peroxidase conjugate were added to wells and incubated at RT for 1 h After washing with ashing buffer eight times 100H9262l TMB substrate was added each well and incubated at RT for 30 min Hundred micro 23 liters each a the lated 2 12 and ANO ficant 3 3 1 tr CTLA4Hing cells DN follo rabbit bit protein W transfected ti from body the spik 3 2 were of were statistical Th1 Th2 le 3 3 body polypeptide based in i p S DN tralizing immunized oral Fig 1 Prominent immunoreactive protein bands of about 90 and 110 kDa were visible on the Western blot lanes 1 and 2 indicating antigen antibody interactions between the 293 cell lysates obtained from 293 cells transfected with tPA optimize800 and CTLA4HingeSARS800 respectively and hyper immune polyclonal serum from rabbit immunized with His 6 tagged recom binant spike polypeptide No antigen antibody interactions were observed between the 293 cell lysates obtained from 293 cells transfected with tPA optimize800 or CTLA4HingeSARS800 and the pre immune rabbit serum lanes 3 and 4 oral Salmonella tPA S DNA oral Salmonella tPA S DNA boosted with i p S peptide oral Salmonella CTLA4 S DNA and oral Salmonella CTLA4 S DNA boosted with i p S P C Y Woo et al Vaccine of 0 3 M H 2 SO 4 was added and the absorbance of well was measured at 450 nm using TMB buffer as blank Each pooled sample was tested in triplicate and mean absorbance for each pooled sample was calcu Statistical analysis Comparison was made among the serum antibody levels LPI of the various groups of mice using one w