《【病毒外文文獻(xiàn)】2009 The ion channel activity of the SARS-coronavirus 3a protein is linked to its pro-apoptotic function》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2009 The ion channel activity of the SARS-coronavirus 3a protein is linked to its pro-apoptotic function（8頁珍藏版）》請?jiān)谘b配圖網(wǎng)上搜索。

The International Journal of Biochemistry Marra et al 2003 Rota et al 2003 et al 2003 Thiel et al 2003 encoding replicases various tructural proteins including spike envelope membrane nucleo and a number of accessory proteins Thiel et al 2003 Rota t al 2003 Marra et al 2003 A subset of these viral proteins Abbreviations a a amino acid AO acridine orange ER endoplasmic reticulum opening reading frame SARS CoV severe acute respiratory syndrome onavirus Corresponding author at Department of Biochemistry Faculty of Science The University of Hong Kong Room 509B Mong Man Wai Building Shatin N T Kong SAR China Tel 852 3163 4021 fax 852 2603 7732 E mail address hyechan cuhk edu hk H Y E Chan including 3a are only found in SARS CoV but not other coron aviruses Rota et al 2003 Understanding the molecular functions of these SARS CoV specific proteins would shed light on the life cycle of the virus The SARS CoV 3a locus also known as X1 Rota et al 2003 ORF3 Marra et al 2003 and U274 Tan et al 2004b encodes a 274 a a protein Marra et al 2003 The 3a protein shows cytoplasmic Oostra et al 2006 Tan et al 2004b Yu et al 2004 Yuan et al 2005a Zhong et al 2006 and plasma membrane Ito et al 2005 Lu et al 2006 Tan et al 2004b localization in both transfected and viral infected cells 3a possesses three transmembrane regions a a 34 56 77 99 103 125 in its N terminus and an intracellular C terminal region Marra et al 2003 Rota et al 2003 The central region of 3a carries several conserved sequences which includes a cysteine rich domain a a 127 133 a YxxH9278 domain a a 160 163 and a diacidic domain a a 171 173 which is then followed by the C terminal domain a a 209 264 Oostra et al 2006 Marra et al 2003 Zeng et al 2004 Tan et al 2004b Yu et al 2004 The cysteine rich domain is known to be responsible for homo 357 2725 see front matter 2009 Elsevier Ltd All rights reserved 10 1016 j biocel 2009 04 019 Molecular Biotechnology Programme The Chinese University of Hong Kong Shatin N T Department of Physiology The Chinese University of Hong Kong Shatin N T Hong Kong Department of Anatomy The Chinese University of Hong Kong Shatin N T Hong Kong Department of Biochemistry Medicine The Chinese University of Hong Kong Shatin info history eceived 1 December 2008 eceived in revised form 12 March 2009 ccepted 20 April 2009 abstract The severe acute respirator nia in 2003 The SARS CoV any other coronaviruses virus 3a protein is linked to its yu Zhai a b Ching On Wong d Tsui f Ho Yin Edwin Chan a b c ong SAR China Kong SAR China Kong SAR China China China Kong SAR China ome coronavirus SARS CoV caused an outbreak of atypical pneumo genome encodes several proteins which have no homology to proteins in number of these proteins have been implicated in viral cytopathies One C M Chan et al The International Journal of Biochemistry while the diacidic domain is a trafficking signal responsible for efficient endoplasmic reticulum ER protein export Nishimura and Balch 1997 Both the YxxH9278and diacidic domains play important roles in intracellular protein trafficking of 3a and a deletion mutant a a 160 173 which uncovers these domains abolishes the localization of 3a to the cell surface Tan et al 2004b Further the 3a C terminal domain a a 125 200 has been demonstrated to possess RNA binding activity Sharma et al 2007 Expression of 3a is detected in patients intestinal surface ente rocytes and pneumocytes Zeng et al 2004 Yu et al 2004 Chan et al 2005 Both its physical interactions with other viral struc tural proteins including Spike Envelope and Membrane Tan et al 2004b and its incorporation into newly packaged matured SARS CoV virions Shen et al 2005 Ito et al 2005 suggest that 3a plays a structural role in the SARS CoV life cycle Apart from being a viral structural protein 3a has been shown to regulate various cellular responses of host cells including the up regulation of fibrinogen gene expression Tan et al 2005 and augmentation of IL 8 and NF H9260B promoter activities Kanzawa et al 2006 possibly through its RNA binding activity Sharma et al 2007 It has been reported that apoptosis initiates viral cytopathic effect in SARS CoV infected cells Ren et al 2005 Bordi et al 2006 Yan et al 2004 Consistent with the viral cytopathologi cal studies a number of SARS CoV proteins including 3a Wong et al 2005 Law et al 2005 are found to be pro apoptotic Tan et al 2004a 2007a b Surjit et al 2004 Chow et al 2005 Lin et al 2006 Yu et al 2004 Yuan et al 2005b Yang et al 2005 Zhao et al 2006 Khan et al 2006 Kopecky Bromberg et al 2006 Chan et al 2007 Previously we and others showed that both caspase 8 Law et al 2005 Padhan et al 2008 and cytochrome c Padhan et al 2008 Wong et al 2005 are involved in 3a induced apoptosis More recently Padhan et al 2008 reported that Bax p53 and p38 MAP kinase also play roles in 3a induced apopto sis The SARS CoV 3a protein appears to have multiple functions including apoptosis induction Although the cysteine rich YxxH9278 and diacidic domains are well known protein motifs on 3a Fig 1A it still remains unclear how these domains are involved in 3a func tions In the present study we performed a structure function study of 3a with an aim to investigate the roles of these domains in its pro apoptotic function in vitro and in vivo In addition the cysteine rich domain had previously been shown to be critical for 3a s ion channel activity Lu et al 2006 our data further illustrate that the ion channel activity is indispensible for caspase dependent apoptosis of 3a 2 Materials and methods 2 1 Generation of 3a mutant constructs The wild type pUAST 3a WT construct Wong et al 2005 was used as template to generate three mutant 3a constructs pUAST 3a CS 3a YA and 3a DE Fig 1A Primers used were CS F 5 prime TTA TGA GAT CTT GGC TTT CTT GGA AGT CCA AAT CCA A 3 prime CS R 5 prime TTG GATTTGGACTTCCAAGAAAGCCAAGATCTCATAA 3 prime Y160A F 5 prime CTGTATACCAGCTAACAGTGTCAC 3 prime Y160A R 5 prime GTG ACA CTG TTA GCT GGT ATA CAG 3 prime DE F 5 prime CGT TAC TGC AGG TGC CGG CAT TTC A 3 prime DE R 5 prime TGA AAT GCC GGC ACC TGC AGT AAC G 3 prime All mutations were confirmed by DNA sequencing For mam malian cell expression both wild type and mutant 3a genes were subcloned into pcDNA vectors to generate pcDNA3 1 3a or pcDNA6 F E6 cells and membr mutant cytoplasm sho retaine mutant endoplasmic subcellular refer article ig 1 Subcellular localization of wild type and mutant SARS CoV 3a proteins in Vero mutant 3a proteins in Vero E6 cells Wild type 3a protein 3a WT displayed plasma protein 3a CS lost the plasma membrane localization and concentrated in the wed cytoplasmic localization and fractional plasma membrane localization was proteins D and E ER Tracker TM Red was used as a counter stain to label the distribution of 3a WT and mutant 3a proteins For interpretation of the A Mutagenesis scheme of this study B E Subcellular localization of wild type ane and punctate cytoplasmic staining pattern B The cysteine rich domain and the perinuclear region C Both 3a YA D and 3a DE E mutant proteins d Different degrees of protein aggregation were also observed in 3a YA and 3a DE reticulum shown in red Scale bar represents 16H9262m F Quantification of ences to color in this figure legend the reader is referred to the web version of the 2234 C M Chan et al The International Journal of Biochemistry BD Biosciences anti cytochrome C 1 2000 Abcam anti glutamate dehydrogenase GDH 1 1000 US Biological and anti H9252 tubulin 1 10 000 Developmental Studies Hybridoma Bank were seeded onto 24 well plates 24 h prior to transfection and H9262g of DNA was used for transient transfection Lipofectamine vitrogen and PLUS transfection reagents Invitrogen were used ding to manufacturer s instructions Immunofluorescence staining of Vero E6 cells Cells were seeded onto coverslips at a density of 2 10 5 cells coverslip After transient transfection cells were ed with 3 7 formaldehyde in 1 PBS for 15 min and then d by 1 Triton X 100 in 1 PBS for 5 min After king with 1 goat serum in 1 PBS for 30 min cells were ed with mouse anti SARS 3a antibody X98 1 40 Wong t al 2005 at4 C overnight Alexa Fluor 488 goat anti rabbit H L 1 400 Invitrogen was used as secondary antibody reticulum was labeled by ER Tracker TM Red 5H9262M TR glibenclamide Invitrogen and cell nuclei were stained Hoechst 33342 5H9262M trihydrochloride trihydrate Molecular obes at room temperature for 10 min Fluorescent images were tured using an Olympus BX51 upright fluorescence microscope a Bio Rad confocal microscope Caspase assays and potassium channel blockers treatment Caspase activity assays were measured using the Caspase Glo 8 Caspase Glo 9 assay systems Promega according to manu acturer s instructions Cell permeable synthetic caspase inhibitors ck z VAD fmk z IETD fmk and z LEHD fmk were dissolved DMSO Potassium channel blockers barium chloride Ba and 4 yridine AP were dissolved in sterile distilled water Vero E6 transiently transfected with 3a constructs were treated with inhibitors 50H9262M in 1 DMSO at 48 h post transfection cells were further incubated for another 24 h For potassium hannel blockers treatment 3a transfected Vero E6 cells were eated with Ba or AP at 24 h post transfection and cells were then cultured for another 48 h After treatments cells were sub ed to immunofluorescence staining as described above Electrophysiology The ion conducting property of 3a was assessed by whole cell h clamp Human embryonic kidney HEK 293 cells were trans ected with GFP tagged 3a WT 3a CS 3a YA or 3a DE constructs enty four hours after transfection cells were trypsinized and ded on poly l lysine coated coverslips Single cells with GFP escence were selected for patch clamp recording Whole cell ents were recorded by an EPC9 patch clamp amplifier HEKA olled by Pulse software HEKA The intracellular solution con d in mM 140 KCl 5 NaCl 2 MgCl 2 10 Hepes at pH 7 2 Bath contained in mM 140 NaCl 5 KCl 2 MgCl 2 1 CaCl 2 10glu 10 Hepes at pH 7 4 The voltage clamp protocol consisted of ectangular voltage steps from 100 to 100 mV in 20 mV incre applied from a holding potential of 60 mV Whole cell ents were recorded before and 5 min after 10 mM Ba applica Lu et al 2006 The experiments were performed at room emperature The data was analyzed with PulseFit software HEKA University of Iowa Iowa City IA under the auspices of the National Institute for Child Health and Human Development and secondary antibodies used were goat anti mouse IgG H L peroxidase conju gate 1 2 500 Abcam and goat anti rabbit IgG H L peroxidase conjugate 1 4000 Cell Signaling 2 7 Drosophila genetics Fly strains were grown at 29 C on standard cornmeal medium supplemented with dry yeast The gmr GAL4 driver line was obtained from Bloomington Drosophila Stock Center and the UAS 3a WT line was previously described in Wong et al 2005 Standard microinjection procedure was employed to generate mutant 3a transgenic lines UAS 3a CS UAS 3a YA and UAS 3a DE Using RT PCR expression level of all 3a transgenes was found to be comparable data not shown 2 8 Scanning electron microscopy of adult fly eyes In brief 2 3 day old adult fly heads were fixed in 2 5 glu taraldehyde EM grade Electron Microscopy Sciences in phosphate buffer pH 7 4 for 4 h then post fixed with 1 osmium tetroxide Electron Microscopy Sciences dehydrated to 100 ethanol and critical point dried with liquid CO 2 Gold palladium coated speci mens were examined with a JEOL JSM 6301FE microscope operated at 5 kV Chau et al 2006 2 9 Acridine orange staining of Drosophila larval eye discs Acridine orange AO staining of third instar larval eye discs was performed as previously described Hay et al 1995 Larvae of corresponding genotypes were fed on either unmodified standard cornmeal medium as described above or medium supplemented with Ba since first instar larval stage Both 1 and 10H9262M Ba gave sim ilar results Eye disc images were captured using an Olympus BX51 upright fluorescence microscope or a Leica NT confocal microscope 2 10 Statistical analyses Statistical analyses were performed using Student s t test Data were presented as means S E M and p values 0 05 were consid ered statistically significant 3 Results 3 1 Subcellular localization of SARS CoV 3a protein and its mutants in Vero E6 cells We performed site directed mutagenesis on three domains of 3a cysteine rich 3a CS C127S C130S C133S YXXH9278 3a YA Y160A and diacidic 3a DE E171A D173A in an attempt to investigate the functional significance of these regions on 3a function in vitro and in vivo Fig 1A Immunofluorescence staining was first performed on these mutant 3a proteins in Vero E6 cells We found that wild type 3a 3a WT protein localized to the plasma membrane Fig 1B and F and also displayed a punctate cytoplasmic staining pattern Fig 1B and F In contrast to 3a WT the 3a CS mutant protein lost the plasma membrane localization and became more concentrated C M Chan et al The International Journal of Biochemistry p 0 05 3a mutant expressing cells versus 3a WT expressing cells At least y reduced nuclear condensation induced by 3a WT protein in Vero E6 cells WT cells versus 3a WT control E and F Caspase 8 and 9 activities were detected educed in mutant 3a expressing cells p 0 05 3a mutant expressing cells versus pathways When we treated 3a WT expressing Vero E6 cells with a broad spectrum caspase inhibitor z VAD fmk Van Noorden 2001 which blocks caspase dependent apoptosis in general a similar level of inhibition was again observed Fig 2D Consistent with the caspase inhibition results we further showed that the activities of caspase 8 and 9 were significantly reduced in all 3a mutant expressing cells Fig 2E and F Truncation of Bid and mitochondrial cytochrome c release are hallmark features of death receptor and mitochondria mediated apoptotic pathways respectively Strasser et al 2009 Here we show that 3a WT protein induced Bid cleav age Fig 3A and mitochondrial cytochrome c release Fig 3B Taken together our data demonstrate that the disruption of the CS YA or DE motif individually does not diminish the ability of 3a to activate the death receptor and mitochondrial apoptotic pathways Fig 3 which is indicative of functional redundancy of these motifs on 3a induced apoptosis 3 3 3a mutants are less potent in triggering apoptosis in vivo We further investigated the pro apoptotic property of 3a mutants in vivo We previously reported that overexpression of 3a WT protein caused a rough eye phenotype and the eye size was also reduced due to excessive cell death Wong et al 2005 Fig 4B In contrast overexpression of 3a CS 3a YA and 3a DE mutants showed only mild rough eye phenotype Fig 4C E and the eye size of these flies was also comparable to the gmr GAL4 driver control Fig 4A Nevertheless we found that both 3a WT Fig 4G and 3a mutants Fig 4H J caused disruption of external eye morphology by scanning electron microscopy Acridine orange AO staining was performed to determine the pro apoptotic property of 3a mutants in flies Acridine orange is a dye which specifically stains apoptotic cells Hay et al 1995 As previously reported Wong et al 2005 3a WT expressing trans genic animals displayed an increased number of AO positive cells Fig 5B when compared to the gmr GAL4 driver control Fig 5A In 2236 C M Chan et al The International Journal of Biochemistry tBid truncated Bid 16 kDa B Upon STS treatment cytochrome c was detected in the cytosolic fraction of untransfected HEK293 cells Cytosolic cytochrome c was also detected in cells transfected with 3a WT CS YA and DE constructs Gluta mate dehydrogenase GDH a mitochondrial marker was used to demonstrate the cytosolic fractions were free of mitochondrial contamination Staurosporine 1H9262M was used to induce apoptosis and H9252 tubulin was used as loading control contrast to 3a WT relatively few number of AO positive cells were detected in 3a CS 3a YA and 3a DE mutant animals Fig 5C E Consistent with the Vero E6 cells data Fig 2 our in vivo results further validate the importance of cysteine rich YxxH9278 and diacidic domains of 3a Fig 1A in 3a s pro apoptotic function 3 4 Ion channel activity of 3a is involved in caspase dependent apoptosis It was reported that 3a possesses ion channel property Lu et al 2006 here we performed electrophysiological measurements to validate the ion channel activity of 3a WT in mammalian cells Fig 6A and B Isolated HEK293 cells expressing 3a WT EGFP protein were picked according to the GFP signal Cells express ing 3a WT EGFP displayed a larger membrane current over the potential range Fig 6B when compared to the mock transfected cells Fig 6A We also detected channel activities in 3a YA EGFP and 3a DE EGFP expressing cells Fig 6C and D however the activities were found to be different from that observed in 3a WT EGFP expressing cells Notably 3a CS EGFP expressing cells displayed whole cell currents that were similar to that of mock transfected cells Fig 6E indicating the 3a CS mutant protein lacks ion channel activity We further found that addition of ion channel blocker barium chloride Ba altered the cell membrane current mediated by 3a WT EGFP 3a YA EGFP and 3a DE EGFP proteins Fig 6B D However Ba displayed no observable effect on 3a CS EGFP expressing cells Fig 6E It has been reported that the Cys 133 residue of the 3a WT pro tein is responsible for homo dimer tetramer formation and is also essential for 3a s ion channel activity Lu et al 2006 As ion chan nel activity has been implicated in apoptosis Burg et al 2006 we investigated whether disrupting the ion channel property of 3a would affect its pro apoptotic function To intervene the ion chan nel function we treated 3a WT transfected Vero E6 cells with ion Fig 4 In vivo expression of wild type and mutant 3a disrupt adult eye structures in Dr to the gmr GAL4 driver alone control A expression of the 3a WT protein in eye tissues adult external eye structure Expression of mutant 3a proteins 3a CS 3a YA and 3a DE microscopic examination of adult fly eyes Expression of 3a WT caused severe loss of sensor of 3a CS 3a YA and 3a DE mutants caused less severe loss of sensory bristles H J Scale channel blockers 4 aminopyridine AP or Ba and found that both inhibitors were able to suppress 3a WT induced nuclear conden sation Fig 6F It has previously been shown that the C133S point mutation Lu et al 2006 compromised 3a s ion channel activity As expected both AP and Ba treatment exerted no further suppressive osophila A E Light microscopic examination of adult fly eyes When compared resulted in rough eye phenotype B as characterized by loss of regularity of the showed minimal dominant external eye phenotype C E F J Scanning electron y bristles G when compared to the gmr GAL4 control F while the expression bar represents 20H9262m C M Chan et al The International Journal of Biochemistry Fig 6 both our in vitro and in vivo data ly demonstrate a linkage between the pro apoptotic property ion channel activity of 3a Discussion We previously showed that the SARS CoV 3a protein induces apoptosis both in vitro and in vitro Wong et orange AO staining was performed on third instar larval eye imaginal discs to 3a WT expression induced apoptosis as indicated by an increase in the number of but to a less extent when compared to 3a WT B as indicated by the relatively less epresents 50H9262m properties of 3a The 3a WT B YA C DE D but not 3a CS E proteins display ansfected with cDNA encoding for 3a WT EGFP B 3a YA EGFP C and 3a DE EGFP ere recorded under voltage steps before diamond and 5 min after square 10 mM tructs were treated with potassium ion channel blockers 4 aminopyridine AP on untransfected cells Nuclear condensation induced by 3a WT expression did not result in any significant inhibitory effect on 3a CS expressing cells ol because neither AP nor Ba exerted any suppressive effect on STS induced cell essed as means S E M of three independent experiments At least 100 cells were WT contro