《【病毒外文文獻(xiàn)】2004 Discovery of Novel Human and Animal Cells Infected by the Severe Acute Respiratory Syndrome Coronavirus by Replicat》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2004 Discovery of Novel Human and Animal Cells Infected by the Severe Acute Respiratory Syndrome Coronavirus by Replicat（11頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

JOURNAL OF CLINICAL MICROBIOLOGY July 2004 p 3196 3206 Vol 42 No 7 0095 1137 04 08 00H110010 DOI 10 1128 JCM 42 7 3196 3206 2004 Copyright 2004 American Society for Microbiology All Rights Reserved Discovery of Novel Human and Animal Cells Infected by the Severe Acute Respiratory Syndrome Coronavirus by Replication Specific Multiplex Reverse Transcription PCR Laura Gillim Ross 1 Jill Taylor 1 David R Scholl 2 Jared Ridenour 2 Paul S Masters 1 3 and David E Wentworth 1 3 Wadsworth Center New York State Department of Health 1 and Department of Biomedical Sciences State University of New York 3 Albany New York 12002 and Diagnostic Hybrids Inc Athens Ohio 45701 2 Received 20 November 2003 Returned for modification 27 January 2004 Accepted 4 April 2004 The severe acute respiratory syndrome coronavirus SARS CoV is the causative agent of the recent out break of severe acute respiratory syndrome VeroE6 cells fetal rhesus monkey kidney cells and human peripheral blood mononuclear cells were the only cells known to be susceptible to SARS CoV We developed a multiplex reverse transcription PCR assay to analyze the susceptibility of cells derived from a variety of tissues and species to SARS CoV Additionally productive infection was determined by titration of cellular superna tants Cells derived from three species of monkey were susceptible to SARS CoV However the levels of SARS CoV produced differed by 4 log 10 Mink lung epithelial cells Mv1Lu and R Mix a mixed monolayer of human lung derived cells A549 and mink lung derived cells Mv1Lu are used by diagnostic laboratories to detect respiratory viruses e g influenza virus they were also infected with SARS CoV indicating that the practices of diagnostic laboratories should be examined to ensure appropriate biosafety precautions Mv1Lu cells produce little SARS CoV compared to that produced by VeroE6 cells which indicates that they are a safer alternative for SARS CoV diagnostics Evaluation of cells permissive to other coronaviruses indicated that these cell types are not infected by SARS CoV providing additional evidence that SARS CoV binds an alternative receptor Analysis of human cells derived from lung kidney liver and intestine led to the discovery that human cell lines were productively infected by SARS CoV This study identifies new cell lines that may be used for SARS CoV diagnostics and or basic research Our data and other in vivo studies indicate that SARS CoV has a wide host range suggesting that the cellular receptor s utilized by SARS CoV is highly conserved and is expressed by a variety of tissues An outbreak of severe acute respiratory syndrome SARS occurred in Guangdong Province People s Republic of China in November 2002 39 From China SARS spread to 30 other countries and as of September 23 2003 this outbreak had resulted in 8 098 reported cases of which 774 were fatal http www who int csr sars country table2003 09 23 en Through the coordinated efforts of laboratories around the world a novel coronavirus CoV designated SARS coronavirus SARS CoV was identified as the causative agent of SARS 6 9 14 24 25 This discovery was quickly followed by the publication of the complete genomic sequences of two SARS CoV isolates and identification of specific subgenomic RNAs sgRNAs and proteins involved in replication 19 28 33 The origin of SARS CoV has not been determined but evidence strongly suggests that its emergence may be the result of zoo notic transmission s 10 CoVs order Nidovirales family Coronaviridae are diverse enveloped positive stranded RNA viruses that produce a nested set of sgRNA molecules during replication 11 16 CoVs are placed into group 1 2 or 3 based on antigenic and genetic criteria 11 16 The genome of SARS CoV has con siderable nucleotide divergence from that of other known hu man CoVs HCoVs 14 19 28 However phylogenetic anal ysis of the SARS CoV replicase gene demonstrated that despite a number of unique features SARS CoV is most closely related to group 2 CoVs 32 Group 2 includes mouse hepatitis virus MHV bovine coronavirus and HCoV OC43 The CoV genome approximately 27 to 32 kb in length is the largest found in any of the RNA viruses Large spike S glycoproteins protrude from the virus particle giving CoVs a distinctive corona like appearance when visualized by electron microscopy The S protein is the major viral attachment pro tein critical to virus binding and fusion of the viral envelope with cellular membranes CoVs infect a wide variety of species including dogs cats pigs mice cows birds and humans 11 16 However the natural host range of each CoV strain is narrow typically consisting of a single species 11 16 CoVs enter cells by receptor mediated endocytosis or by fusion with the plasma membrane 11 16 The S protein receptor interaction is a major determinant of species speci ficity and tissue tropism for both group 1 and group 2 CoVs This finding is best illustrated by the fact that CoV genomic RNA gRNA is infectious when transfected into nonpermis sive cells and that transfection of nonpermissive cells with constructs expressing CoV receptors renders them susceptible to infection 4 8 11 13 16 36 The receptor for group 1 CoVs including HCoV 229E feline CoVs and porcine CoVs is aminopeptidase N APN 4 34 38 Although APN is highly conserved it is generally used in a species specific man ner 13 35 CEACAM1a the best characterized CoV recep Corresponding author Mailing address Wadsworth Center NYSDOH 120 New Scotland Ave Albany NY 12208 Phone 518 408 2396 Fax 518 473 1326 E mail dwentwor wadsworth org 3196 on March 21 2015 by QUEENS UNIV BRACKEN LIB http jcm asm org Downloaded from tor and a principal determinant of the tissue tropism and re stricted host range of MHV 3 7 8 30 is utilized by different strains of MHV which is a group 2 CoV 11 SARS CoV was first isolated in African green monkey kid ney VeroE6 cells and fetal rhesus monkey kidney FRhMK cells inoculated with clinical specimens 6 14 24 26 Based on cytopathic effect CPE other cells routinely used for iden tification of respiratory pathogens MDCK A549 NCI H292 HeLa LLC MK2 Hut 292 B95 8 MRC 5 RDE and Hep 2 were determined to be nonpermissive to SARS CoV infection 6 14 24 Additionally human peripheral blood mononuclear cells PBMCs were shown by reverse transcriptase PCR RT PCR to support SARS CoV replication 17 To determine the in vitro host range analyze potential receptors and iden tify additional human cell lines permissive to SARS CoV a multiplex RT PCR assay for the detection of SARS CoV rep lication was developed Cells routinely used by clinical diag nostic laboratories for pathogen screening were specifically analyzed to determine their susceptibility to SARS CoV Ad ditionally primary cells and continuous cell lines derived from a number of species and tissues were analyzed for their sus ceptibilities to SARS CoV This study identified novel human and animal cells that support SARS CoV replication MATERIALS AND METHODS Propagation and titration of virus A seed stock of SARS CoV strain Urbani that was passaged twice in VeroE6 cells was kindly provided by W Bellini and T Ksiazek of the Centers for Disease Control and Prevention Atlanta Ga This virus was amplified by two passages in VeroE6 cells to establish a high titer stock passage 4 that was utilized in all experiments The 50 tissue culture infectious dose TCID 50 per ml was determined for SARS CoV in VeroE6 cells by the observation of CPE as previously described 35 Briefly cells were plated in 96 well plates Falcon Becton Dickinson at a density of 5 H11003 10 4 cells well in 150 H9262l of medium The virus was serially diluted by half logs from 10 0 to 10 H110028 in culture medium One hundred microliters of each dilution was added per well and the cells were incubated 3 to 4 days at 37 C Biosafety containment All experiments with infectious SARS CoV were per formed in a Biosafety Level 3 laboratory and were conducted under appropriate conditions using precautions that adhered to or exceeded the requirements set forth by the Centers for Disease Control and Prevention Interim Laboratory Biosafety Guidelines for Handling and Processing Specimens Associated with SARS Procedures performed with SARS CoV included viral propagation stor age of stocks inoculation of various cell lines and RNA extraction Cell lines The following cell lines were obtained from the American Type Culture Collection Rockville Md VeroE6 MRC 5 BHK 21 MDCK HRT 18 HCT 18 Mv1Lu CMT 93 AK D and A549 R Mix R Mix FreshCells DHI number 96 T025 Diagnostic Hybrids Inc Athens Ohio is a mixed monolayer of mink lung cells strain Mv1Lu and human adenocarcinoma cells strain A549 HEK 293T cells were kindly provided by Yoshihiro Kawaoka University of Wisconsin Madison Huh 7 cells were kindly provided by Aleem Siddiqui University of Colorado Health Sciences Center Denver BHK 21 and CMT 93 cells were transfected with a human APN hAPN expression plasmid described previously 35 pRhMK and pCMK cells were derived from adult U S bred animals DHI numbers 49 T025 and 47 T025 respectively HEL cells were obtained from the Wadsworth Center Tissue Culture Facility Chicken embryo fibroblast CEF cells were obtained from Charles River Laboratories Inc Wilmington Mass Unless stated otherwise all cell lines were maintained in base medium supplemented with 10 fetal bovine serum FBS HyClone Logan Utah 200 U of penicillin G ml 200 H9262g of streptomycin sulfate ml and 0 5 H9262g of amphotericin B Invitrogen Corp ml VeroE6 HEK 293T L2 AK D A549 FCWF pCMK pRhMK and CMT 93 cells were maintained in Dulbec co s modified Eagle medium DMEM MDCK cells were maintained in DMEM supplemented with 5 FBS HEL Mv1Lu R Mix and CEF cells were main tained in modified Eagle s medium MEM HRT 18 cells were maintained in RPMI 1640 Invitrogen Corp supplemented with 10 horse serum HyClone and 1 mM sodium pyruvate Invitrogen Corp Huh 7 cells were maintained in DMEM supplemented with 20 FBS MRC 5 cells were maintained in MEM supplemented with 1 mM sodium pyruvate and 0 1 mM MEM nonessential amino acids Invitrogen Corp BHK 21 cells were maintained in DMEM sup plemented with tryptose phosphate broth 1 48g liter Invitrogen Corp Inoculation of cells and RNA isolation Cells seeded at a density of 2 H11003 10 6 in T25 flasks Falcon Becton Dickinson 1 day prior to the experiment were inoculated with the virus at a multiplicity of infection MOI of H110110 001 in a final volume of 1 ml or were mock inoculated and incubated1hat37 C The virus was removed 1 h and 5 ml of fresh medium was added to each flask The cells were maintained at 37 C throughout the experiment At 1 24 or 48 h postinoculation the cells were observed for CPE the supernatants were collected for subsequent titration and total RNA was extracted by using TRIZOL reagent Invitrogen Corp and quantitated by spectrophotometer Eppendorf Mock inoculations were collected at 48 h postinoculation Multiplex RT PCR analysis of SARS CoV replication Glyceraldehyde 3 phos phate dehydrogenase G3PDH and SARS CoV gRNA and sgRNA were de tected by using multiplex one step RT PCR Five oligonucleotide primers were used to simultaneously amplify three different targets G3PDH was amplified with G3P 279 5H11032 CATCACCATCTTCCAGGAGC 3H11032 a sense primer that cor responds to human G3PDH from base 279 to base 299 and G3P 1069R 5H11032 C TTACTCCTTGGAGGCCATG 3H11032 an antisense primer that is complementary to human bases 1049 to 1069 gRNA was specifically amplified with SARS 21 263 5H11032 TGCTAACTACATTTTCTGGAGG 3H11032 a sense primer that corresponds to bases 21 263 to 21 284 of SARS CoV Urbani and SARS 21 593R 5H11032 AGTAT GTTGAGTGTAATTAGGAG 3H11032 an antisense primer complementary to bases 21 571 to 21 593 of SARS CoV Urbani 28 sgRNA was specifically amplified by using SARS 1 5H11032 ATATTAGGTTTTTACCTACCCAGG 3H11032 a sense primer corresponding to bases 1 to 24 of SARS CoV Urbani and SARS 21 593R Am plification was carried out by using the QIAGEN OneStep RT PCR kit Briefly each reaction consisted of 2 H9262g of total RNA template 400 H9262M each dNTP 200 nM each G3PDH primer 400 nM SARS 1 400 nM SARS 21 263 600 nM SARS 21 593R 2 H9262l QIAGEN enzyme mix in a final volume of 25 H9262l The cycling parameters were 50 C for 30 min 95 C for 15 min 35 cycles of 94 C for 30 s 57 to 58 C for 30 s and 72 C for 1 min followed by 10 min at 72 C in an Eppendorf Mastercycler gradient To eliminate nonspecific products amplified in some cell lines different cycling parameters were used for samples from HEL R Mix A549 MRC 5 MDCK AK D and HRT cells Briefly the touchdown parame ters were 50 C for 30 min 95 C for 15 min 10 cycles of 94 C for 30 s 62 3 C for 30s H110020 3 C cycle 72 C for 1 min 24 cycles of 94 C for 30 s 59 3 C for 30 s and 72 C for 1 min followed by 10 min at 72 C Amplification products were ana lyzed by electrophoresis through a 1 5 agarose gel and visualized by ethidium bromide staining Primers were synthesized by the Wadsworth Center Molecular Genetics Core or Invitrogen Corp Flow cytometry Expression levels of hAPN were determined by fluorescence activated cell sorter FACS analysis as described previously 35 DW 1 a monoclonal antibody that recognizes hAPN in the conformation recognized by the HCoV 229E S glycoprotein was utilized Phycoerythrin conjugated goat F ab H11032 2 anti mouse immunoglobulin DAKO was used for detection Mouse immunoglobulin G2 antibody was included as an isotype control Pharmingen Becton Dickinson Franklin Lakes N J The cells were analyzed by a FACS Calibur flow cytometer Becton Dickinson and data were analyzed using FlowJo software Tree Star Inc San Carlos Calif RESULTS Detection of virus entry and replication initiation To iden tify an early step in the initiation of SARS CoV infection a novel multiplex RT PCR assay for the detection of SARS CoV replication was developed This assay takes advantage of the fact that 3H11032 coterminal sgRNAs which share the same short 5H11032 leader sequence are produced by corona and arteriviruses upon entry Fig 1A 5 16 29 The multiplex RT PCR assay distinguished between the mere presence of input virus which may be nonproductive and actual initiation of replication en try Oligonucleotide RT PCR primers were designed to amplify G3PDH and SARS CoV gRNA and sgRNA the latter of which is indicative of virus entry and specific to initiation of SARS CoV RNA replication Fig 1A gRNA was detected by amplification of a region between the 1b coding region of the VOL 42 2004 SARS CoV INFECTS CELLS FROM DIVERSE SPECIES 3197 on March 21 2015 by QUEENS UNIV BRACKEN LIB http jcm asm org Downloaded from polymerase gene and the sequence encoding the S protein sgRNA was detected by using a primer specific to the leader sequence in conjunction with the same reverse primer in the S gene that was used for gRNA detection G3PDH primers designed to amplify G3PDH from multiple species served as positive controls for RNA integrity and cDNA production To evaluate the multiplex RT PCR assay VeroE6 cells were inoculated with serial dilutions of SARS CoV ranging from 10 6 to 10 H110022 TCID 50 Total RNA was extracted at 1 or 24 h post inoculation At 1 h input gRNA was detected in cells inocu lated with 10 6 to 10 3 infectious particles as indicated by a band at bp 300 Fig 1B while sgRNA was not detected bp 180 However at 24 h postinoculation both gRNA and sgRNA at bp 300 and bp 180 respectively were detected in cells inocu lated with 10 6 to 10 1 TCID 50 Fig 1B The sgRNA amplicon was confirmed by sequence analysis to correspond to the S sgRNA leader body junction determined by Thiel et al 33 data not shown G3PDH was included as a control for RNA quality and was always detected in the absence of viral RNAs Fig 1B The multiplex reaction conditions were optimized to favor amplification of SARS CoV RNA species at the expense of G3PDH amplification which reduced the amplification of G3PDH when high levels of SARS CoV gRNA and sgRNA were present Fig 1B Additionally low levels of G3PDH RNA in some samples may have been due to cell death Kidney cells derived from three species of monkey are sus ceptible to SARS CoV SARS CoV has been successfully prop agated in VeroE6 cells derived from African green monkeys and FRhMK cells derived from fetal rhesus monkeys 14 24 In addition cynomolgus monkeys were the first animals tested as a model for SARS CoV infection 9 15 To compare kid ney cells from three species of monkeys and a divergent species Syrian hamster VeroE6 cells primary kidney cells derived from rhesus macaques pRhMK and cynomolgus macaques pCMK and baby hamster kidney cells BHK 21 were inoc ulated with SARS CoV MOI H110110 001 SARS CoV gRNA was detected in VeroE6 pRhMK and pCMK cells at 1 h input virus and had qualitatively increased at 24 h Fig 2A sgRNA absent from input virus 1 h was detected at 24 and 48 h in VeroE6 pRhMK and pCMK cells indicating that FIG 1 Identification of SARS CoV entry and replication initiation A Schematic of CoV RNA replication and depiction of the PCR strategy used to detect SARS CoV replication gRNAs and sgRNAs are depicted negative sense sgRNAs are omitted for simplicity L represents the short leader sequence Oligonucleotides are depicted by the arrows Primers 1 and 2 specifically amplify gRNA whereas primers 2 and 3 specifically amplify spike sgRNA B Approximately 1 H11003 10 6 VeroE6 cells were inoculated with serial dilutions of SARS CoV ranging from 10 6 to 10 H110022 TCID 50 or were mock inoculated M G3PDH and SARS CoV gRNA and sgRNA were amplified by multiplex RT PCR of total RNA isolated at 1 or 24 h postinoculation L denotes the molecular weight ladder Amplicons were visualized by ethidium bromide staining after electrophoresis and negative images are shown 3198 GILLIM ROSS ET AL J CLIN MICROBIOL on March 21 2015 by QUEENS UNIV BRACKEN LIB http jcm asm org Downloaded from SARS CoV initiated replication in cells from all three monkey species In SARS CoV inoculated BHK 21 cells gRNA was detected in the viral inoculum at 1 h but was not detected at 24 h Fig 2A Additionally sgRNA was not detected in these cells G3PDH was amplified in all samples lacking gRNA and sgRNA an indication that the RNA was intact The supernatants were collected and the titers of the virus were determined at various times postinoculation to compare the amount of SARS CoV produced by the various species The susceptible cells demonstrated an increase in virus titer at 48 h postinoculation whereas SARS CoV was not detected in the supernatants from BHK 21 cells at 24 or 48 h Fig 2B Interestingly the level of SARS CoV production differed among the three monkey species pCMK cells demonstrated a much lower titer 2 1 H11003 10 3 TCID 50 ml at 24 h than either pRhMK 4 9 H11003 10 5 TCID 50 ml or VeroE6 3 8 H11003 10 7 TCID 50 ml cells At 48 h the titer from pCMK cells increased to 7 8 H11003 10 4 TCID 50 ml and the titer from pRhMK cells increased to 5 6 H11003 10 5 TCID 50 ml while the titer from VeroE6 cells leveled off at 3 9 H11003 10 7 TCID 50 ml Consistent with reports by Ksiazek et al CPE was observed in VeroE6 cells at as early as 24 h 14 However significant CPE was not observed in pRhMK or pCMK cells at 24 or 48 h or even at 5 days postinoculation data not shown These data indicate that the identification of newly synthesized sgRNA is a more reliable indicator of SARS CoV entry and replication than CPE Identification of clinically relevant cells permissive to SARS CoV infection A panel of cells routinely used by diag nostic laboratories to isolate respiratory pathogens was ana lyzed for susceptibility to SARS CoV Human embryonic lung cells HEL support detection of rhinovirus and respiratory syncytial virus RSV from clinical specimens HEL cells were inoculated with SARS CoV MOI H110110 001 and the produc tion of SARS CoV RNA was analyzed SARS CoV gRNA was detected at 1 h postinoculation input virus but was not de tected at 24 or 48 h Fig 3A sgRNA was not detectable in